Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

BRAT1 Gene

protein-coding GIFtS: 47
GCID: GC07M002577

BRCA1-associated ATM activator 1

(Previous name: chromosome 7 open reading frame 27 )
(Previous symbols: C7orf27, BAAT1)

Explore 5 diseases affiliated with
BRAT1 via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
BRCA1-Associated ATM Activator 1¹ ²		MGC22916¹
BAAT1¹ ² ³		Chromosome 7 Open Reading Frame 27¹
C7orf27¹ ² ³		RMFSL²
BRCA1-Associated Protein Required For ATM Activation Protein 1² ³		HEAT Repeat-Containing Protein C7orf27²

External Ids:	HGNC: 21701¹	Entrez Gene: 221927²	Ensembl: ENSG00000106009⁷	OMIM: 614506⁵	UniProtKB: Q6PJG6³

Export aliases for BRAT1 gene to outside databases

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for BRAT1:

The protein encoded by this ubiquitously expressed gene interacts with the tumor suppressing BRCA1 (breast cancer 1)

protein and and the ATM (ataxia telangiectasia mutated) protein. ATM is thought to be a master controller of cell

cycle checkpoint signalling pathways that are required for cellular responses to DNA damage such as double-strand

breaks that are induced by ionizing radiation and complexes with BRCA1 in the multi-protein complex BASC

(BRAC1-associated genome surveillance complex). The protein encoded by this gene is thought to play a role in the DNA

damage pathway regulated by BRCA1 and ATM. (provided by RefSeq, Mar 2012)

UniProtKB/Swiss-Prot: BRAT1_HUMAN, Q6PJG6

Function: Required for activation of ATM following ionizing radiation. May act by regulating dephosphorylation of ATM

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000007.13 NC_018918.1 NT_007819.17 NT_079592.2

Regulatory elements:

Search SABiosciences Regulatory transcription factor binding sites for BRAT1
Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 3): BRAT1 promoter sequence

Search SABiosciences Chromatin IP Primers for BRAT1

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat BRAT1

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 7p22.3 Ensembl cytogenetic band: 7p22.3 HGNC cytogenetic band: 7p22.3

BRAT1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
BRAT1 gene location

GeneLoc information about chromosome 7 GeneLoc Exon Structure

GeneLoc location for GC07M002577: view genomic region (about GC identifiers)

Start:	2,577,511 bp from pter	End:	2,595,361 bp from pter
Size:	17,851 bases	Orientation:	minus strand

1 alternative location:

Chr7-,CRA_TCAG 2,625,380-2,643,058

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: BRAT1_HUMAN, Q6PJG6 (See protein sequence)

Recommended Name: BRCA1-associated ATM activator 1

Size: 821 amino acids; 88119 Da

Subunit: Interacts with BRCA1 and ATM

Subcellular location: Nucleus. Note=Present at double strand breaks (DSBs) following ionizing radiation treatment

Sequence caution: Sequence=BAB15772.1; Type=Erroneous initiation; Note=Translation N-terminally shortened;

Secondary accessions: A4D200 C9JY24 Q8IW85 Q8IZ43 Q8WVR8 Q96IV9 Q9H7J8 Q9UFA3

Alternative splicing: 3 isoforms: Q6PJG6-1 Q6PJG6-2 Q6PJG6-3 (No experimental confirmation available. Ref.5 (AAH40704) sequence is in conflict in position: 49:P->T)

Explore the universe of human proteins at neXtProt for BRAT1: NX_Q6PJG6

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_Q6PJG6

BRAT1 Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins: NP_689956.2

ENSEMBL proteins:

ENSP00000339637 ENSP00000409209

Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	OriGene Purified Protein: BRAT1 OriGene Protein Over-expression Lysate: BRAT1 OriGene Custom Protein Services for BRAT1
	GenScript Custom Purified and Recombinant Proteins Services for BRAT1
	Novus Biologicals BRAT1 Protein Novus Biologicals BRAT1 Lysates
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for BRAT1

Gene Ontology (GO): 1 cellular component term (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005634	nucleus	IDA	16452482

BRAT1 for ontologies About GeneDecksing

BRAT1 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for BRAT1
	GenScript Custom Superior Antibodies Services for BRAT1
	Novus Biologicals BRAT1 Antibodies
	Search for Antibodies for BRAT1 at Abcam
	Uscn Antibodies for BRAT1
	ThermoFisher Antibodies for BRAT1

Assay Products for BRAT1:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for BRAT1
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for BRAT1

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

BRAT1 for domains About GeneDecksing

3 InterPro domains/families:

IPR000357 HEAT

IPR011989 ARM-like

IPR016024 ARM-type_fold

Graphical View of Domain Structure for InterPro Entry Q6PJG6

ProtoNet protein and cluster: Q6PJG6

UniProtKB/Swiss-Prot: BRAT1_HUMAN, Q6PJG6

Similarity: Contains 2 HEAT repeats

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Function Summary:

UniProtKB/Swiss-Prot: BRAT1_HUMAN, Q6PJG6

Function: Required for activation of ATM following ionizing radiation. May act by regulating dephosphorylation of ATM

miRNA Products:		OriGene 3'-UTR Clone: BRAT1 Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat BRAT1
		Search QIAGEN for miScript miRNA Assays for microRNAs that regulate BRAT1
		SwitchGear 3'UTR luciferase reporter plasmid: BRAT1 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for BRAT1 OriGene shRNA RFP: BRAT1 OriGene siRNA: BRAT1
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat BRAT1

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for BRAT1

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for BRAT1 OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for BRAT1 (see all 2) OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: BRAT1 (NM_152743)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for BRAT1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat BRAT1

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for BRAT1
		Search LifeMap BioReagents cell lines for BRAT1

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for BRAT1

Gene Ontology (GO): 1 molecular function term (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005515	protein binding	IPI	16452482

BRAT1 for ontologies About GeneDecksing

1 GenomeRNAi human phenotype for BRAT1:

Increased gamma-H2AX phosphory

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for BRAT1

STRING Interaction Network Preview (showing 2 interactants - click image to see more details)

2 Interacting proteins for BRAT1 (Q6PJG6³ ENSP00000339637⁴) via UniProtKB, MINT, STRING, and/or I2D

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
UBC	P0CG48³, ENSP00000344818⁴	I2D: score=1 STRING: ENSP00000344818
SUMO2	ENSP00000405965⁴	STRING: ENSP00000405965

About this table

Gene Ontology (GO): 1 biological process term (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0010212	response to ionizing radiation	IMP	16452482

BRAT1 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for BRAT1
Search CenterWatch for drugs/clinical trials and news about BRAT1

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for BRAT1 gene:

NM_152743.3

Unigene Cluster for BRAT1:

BRCA1-associated ATM activator 1

Hs.520623 [show with all ESTs]

Unigene Representative Sequence: NM_152743

6 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000340611(uc003smi.3) ENST00000493232 ENST00000467558 ENST00000469750(uc003smh.4 uc003smj.2)

ENST00000473879 ENST00000421712

miRNA Products:		OriGene 3'-UTR Clone: BRAT1 Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat BRAT1
		Search QIAGEN for miScript miRNA Assays for microRNAs that regulate BRAT1
		SwitchGear 3'UTR luciferase reporter plasmid: BRAT1 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for BRAT1 OriGene shRNA RFP: BRAT1 OriGene siRNA: BRAT1
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat BRAT1

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for BRAT1 OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for BRAT1 (see all 2) OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: BRAT1 (NM_152743)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for BRAT1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat BRAT1

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for BRAT1 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat BRAT1
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat BRAT1
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat BRAT1

Additional cDNA sequence:

AL133088.1 BC007209.1 BC015632.2 BC023561.2

9 DOTS entries:

DT.91746684 DT.95319778 DT.95319768 DT.95319767 DT.101983036 DT.100791018 DT.100791016 DT.121111633

DT.97859408

24/208 AceView cDNA sequences (see all 208):

BU731056 BM931086 AI394324 BC007209 BX284041 AA078181 BQ427534 BM675122

BU556454 BC015632 BE303038 CR604410 NM_152743 BC023561 BE043101 BM694411

AW005320 AL525642 BI335238 BQ045151 AI275736 BM825687 BQ026094 CB216768

GeneLoc Exon Structure

5/13 Alternative Splicing Database (ASD) splice patterns (SP) for BRAT1 (see all 13) About this scheme

ExUns:	1a	·	1b	·	1c	^	2	^	3	^	4	^	5	^	6	^	7a	·	7b	·	7c	·	7d	·	7e	^	8a	·	8b	·	8c	^	9	^	10a	·	10b	^	11	^	12a	·	12b	·	12c	^	13a	·	13b	^	14	^
SP1:									-		-																								-						-										-
SP2:									-		-																								-						-
SP3:																																									-
SP4:																													-		-				-						-
SP5:																																			-

ExUns:	15	^	16	^	17	^	18a	·	18b
SP1:
SP2:
SP3:
SP4:
SP5:

ECgene alternative splicing isoforms for BRAT1

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

BRAT1 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: TCCTTCTGTG

About this image
See BRAT1 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for BRAT1

SOURCE GeneReport for Unigene cluster: Hs.520623

UniProtKB/Swiss-Prot: BRAT1_HUMAN, Q6PJG6

Tissue specificity: Ubiquitously expressed

SABiosciences Custom PCR Arrays for BRAT1

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for BRAT1 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat BRAT1
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat BRAT1
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat BRAT1

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for BRAT1

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of animals.

Orthologs for BRAT1 gene from 5/14 species (see all 14) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
mouse (Mus musculus)	Mammalia	Brat1⁵ Baat1¹	BRCA1-associated ATM activator 1^{1, 5}	77.67(n)¹ 73.69(a)¹		5 (79.25 cM)⁵ 231841¹ NM_181066.2¹ NP_851411.1¹ 140705011⁵
chicken (Gallus gallus)	Aves	BRAT1¹	BRCA1-associated ATM activator 1	55.84(n) 49.2(a)		769893 XM_001233205.2 XP_001233206.2
lizard (Anolis carolinensis)	Reptilia	BRAT1⁶	--	48(a)	1 ↔ 1	GL343340.1(365437-375725)
zebrafish (Danio rerio)	Actinopterygii	brat1¹	BRCA1-associated ATM activator 1	47.01(n) 37.37(a)		678547 NM_001040305.1 NP_001035395.1
fruit fly (Drosophila melanogaster)	Insecta	CG7044⁶	--	14(a)	1 ↔ 1	3R(16923951-16927440)

ENSEMBL Gene Tree for BRAT1 (if available)
TreeFam Gene Tree for BRAT1 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 7 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs145848308^1,2		--	2576970(+)	`AAACTC/GCTGGC`	1	--	ds500¹		0	--	--	--	--
rs149016184^1,2		--	2576979(+)	`GCCTTA/GAACAA`	1	--	ds500¹		0	--	--	--	--
rs112351257^1,2		--	2577005(+)	`CTCCCG/AAAGTG`	1	--	ds500¹		1		CSA	2
rs192655641^1,2		--	2577081(+)	`CCGGGC/TGGAGT`	1	--	ds500¹		0	--	--	--	--
rs183882535^1,2		--	2577207(+)	`AAAAAA/TATTAG`	1	--	ds500¹		0	--	--	--	--
rs189340255^1,2		--	2577248(+)	`AGCTAC/TTCGGG`	1	--	ds500¹		0	--	--	--	--
rs142054344^1,2		--	2577351(+)	`GAAACC/TCCATC`	1	--	ds500¹		0	--	--	--	--
rs181955459^1,2		--	2577377(+)	`ACAGAC/TAGATA`	1	--	ds500¹		0	--	--	--	--
rs185916558^1,2		--	2577476(+)	`TAACTC/GAAAAA`	1	--	ut3¹		0	--	--	--	--
rs145828184^1,2		--	2577484(+)	`AAAGGG/TTTAAA`	1	--	ut3¹		0	--	--	--	--
rs148220310^1,2		--	2577607(+)	`CCACCA/GGGCTG`	1	--	ut3¹		0	--	--	--	--
rs140062589^1,2	C,	--	2577689(+)	`TGGCAA/GACTCT`	1	--	ut3¹		0	--	--	--	--
rs1043294^1,2	C,F,O,A,H,	--	2577691(-)	`CCAGAG/CTCTGC`	1	--	ut3¹ ese³		10		MN NS EA NA EU	1599
rs190232808^1,2	C,	--	2577693(+)	`AGACTC/GTGGTT`	1	--	ut3¹		0	--	--	--	--
rs1043291^1,2	C,F,A,H,	--	2577781(-)	`GTGGAA/GAAGAG`	2	E	syn¹		33		EA NS NA WA CSA EU	9099
rs200892967^1,2		--	2577802(+)	`CTCTCA/GGCCAG`	2	A	syn¹		0	--	--	--	--
rs61729932^1,2	C,F,	--	2577816(+)	`GCTCCG/ACAGGC`	2	/R /W	mis¹		3		NS NA EU	4697
rs144085416^1,2	C	--	2577871(+)	`TCCTGG/TTCCCC`	2	E D	mis¹		1		NA	2776
rs199914857^1,2		--	2577911(+)	`ACCTCA/GGCAGG`	2	P L	mis¹		0	--	--	--	--
rs60152725^1,2	C,F,	--	2577960(+)	`CTCCCG/ACAGGC`	2	/R /W	mis¹		3		WA NA	3780
rs61753093^1,2	C,F,	--	2577961(+)	`TCCCGC/AAGGCT`	2	/L	syn¹		2		NA EU	4629
rs150300694^1,2	C,F,	--	2578000(+)	`AAGAGA/TAGGAG`	2	L	syn¹		1		NA	4186
rs140802292^1,2	C,F,	--	2578022(+)	`TCTGCG/ACCACA`	2	/A /V	mis¹		1		NA	4148
rs200264530^1,2		--	2578078(+)	`CCCACA/GTGGCA`	2	H	syn¹		0	--	--	--	--
rs145833100^1,2	C,F,	--	2578128(+)	`CACCTC/TGGGTA`	2	K E	mis¹		2		NA EU	4121
rs141726264^1,2	C	--	2578140(+)	`GGCCAC/TGGCAT`	2	M V	mis¹		1		NA	3716
rs147119058^1,2	C,	--	2578160(+)	`GGGTAC/TGCGGC`	2	H R	mis¹		1		NA	3430
rs61627394^1,2	C,F,	--	2578181(+)	`TCTGGC/TCCAGG`	2	D G	mis¹		3		NS EA NA	2552
rs186448943^1,2		--	2578197(+)	`GAGGGC/TCAGCT`	2	T A	mis¹		0	--	--	--	--
rs4719552^1,2	C,F,	--	2578237(+)	`AGGTCT/CCGGCT`	2	/R	syn¹ ese³		8		NA CSA WA EA EU	556
rs62907961^1,2	C,F,	--	2578238(+)	`GGTCTC/TGGCTC`	2	Q R	mis¹		2		NA EU	127
rs2917726^1,2	C,F,H,	--	2578246(-)	`CAGGCA/GGCGAG`	2	A	syn¹ ese³		6		NS EA NA	604
rs113030000^1,2	C,	--	2578247(+)	`TCGCCA/GCCTGC`	2	A V	mis¹		1		CSA	1
rs142346283^1,2	C,F,	--	2578285(+)	`TCCTGG/AGCCGC`	2	/A	syn¹		1		NA	2254
rs77015302^1,2	C,F,	--	2578302(+)	`GTGGCC/TGTCCC`	2	S G	mis¹		3		WA CSA	122
rs138077616^1,2	C,F,	--	2578307(+)	`CGTCCC/TGCAGC`	2	Q R	mis¹		1		NA	2270
rs148297849^1,2	C	--	2578308(+)	`GTCCCG/ACAGCC`	2	/R /W	mis¹		1		NA	2232
rs61753094^1,2	C,F	--	2578341(+)	`CGCCCG/ACCGTG`	2	/R /W	mis¹		1		EU	837
rs199501131^1,2		--	2578359(+)	`CTCCGA/CGTCTA`	2	A S	mis¹		0	--	--	--	--
rs56727079^1,2	C,F,	--	2578371(+)	`GGAGAG/AGATGT`	2	/L /F	mis¹		4		NS WA EA EU	1087
rs201523118^1,2		--	2578377(+)	`GATGTA/GCAGGA`	2	H Y	mis¹		0	--	--	--	--
rs185137063^1,2		--	2578433(+)	`TGGTGC/GGGTGG`	1	--	int¹		0	--	--	--	--
rs4721763^1,2	C,F,A,	--	2578434(+)	`GGTGGG/TGTGGC`	1	--	int¹		8		NA WA CSA EA	368
rs149549272^1,2		--	2578477(+)	`CATGAA/TGGGGG`	1	--	int¹		0	--	--	--	--
rs200977076^1,2		--	2578790(+)	`GCTGGC/TTGAGG`	1	--	int¹		0	--	--	--	--
rs141490198^1,2	C	--	2578818(+)	`CTGCCA/G/TGGCCT`	3	R W	syn¹ mis¹		2		NA EU	4631
rs200084998^1,2		--	2578843(+)	`CTGGTA/GGGGGC`	2	P	syn¹		0	--	--	--	--
rs150846882^1,2	C,F	--	2578856(+)	`GCAGGC/GCCTGG`	2	A G	mis¹		1		NA	4342
rs61740320^1,2	C,F,	--	2578857(+)	`CAGGCC/G/TCTGGC`	3	S R G	mis¹		4		NS CSA NA EU	5290
rs146276208^1,2	C,F,	--	2578894(+)	`GCACTC/TGCTCG`	2	A	syn¹		1		NA	4410
rs61746940^1,2	C,F,	--	2578924(+)	`TGGAGG/AAGCTG`	2	/L	syn¹		3		NS NA EU	5555
rs34656552^1,2	C,F,H,	--	2578947(+)	`AGGCAC/ACTCTG`	2	/V /L	mis¹		11		NS NA WA	5612
rs143903118^1,2	F	--	2578963(+)	`AAGAGT/CGCGCA`	2	/A	syn¹		1		NA	4466
rs141753173^1,2	C,	--	2579005(+)	`GGCCAC/TATGCA`	1	--	int¹		0	--	--	--	--
rs116570394^1,2	C,F,	--	2579042(+)	`GCCTCG/AGCCTC`	1	--	int¹		1		WA	118
rs146083473^1,2		--	2579051(+)	`TCTGCC/GTCCAT`	1	--	int¹		0	--	--	--	--
rs114267478^1,2	C,	--	2579134(+)	`GAGCCC/GCCCAC`	1	--	int¹		0	--	--	--	--
rs200635453^1,2		--	2579142(+)	`CACAGA/GCGGGG`	1	--	int¹		0	--	--	--	--
rs142129866^1,2	C	--	2579181(+)	`ACCTCC/TCCAGT`	2	R G	mis¹		1		NA	2582
rs151161353^1,2	F	--	2579196(+)	`GCTCAG/ACTGGG`	2	/L	syn¹		1		NA	2990
rs145509776^1,2	C,F	--	2579211(+)	`GAACTC/GGAGGG`	2	Q E	mis¹		1		NA	3504
rs147745609^1,2	C,F	--	2579268(+)	`CACAGG/AGAACA`	2	/P /S	mis¹		1		NA	3896
rs199506042^1,2		--	2579310(+)	`ACCTTG/TGGGCC`	1	--	int¹		0	--	--	--	--
rs142667367^1,2	F	--	2579431(+)	`GGAACT/CGCGGG`	2	/Q /R	mis¹		1		NA	3822
rs148923187^1,2	C,	--	2579497(+)	`TGAGCG/ATGGCC`	2	/T /M	mis¹		1		NA	3798
rs200500603^1,2		--	2579533(+)	`GCAGAC/TAGGGT`	1	--	int¹		0	--	--	--	--
rs199717809^1,2		--	2579561(+)	`GAGACA/GGAGGG`	1	--	int¹		0	--	--	--	--
rs148748089^1,2		--	2579639(+)	`CAGGAA/TGTGGA`	1	--	int¹		0	--	--	--	--
rs141407073^1,2		--	2579642(+)	`GAAGTC/GGAGAG`	1	--	int¹		0	--	--	--	--
rs77056351^1,2	C,	--	2579691(+)	`GGTCTC/GAATGT`	1	--	int¹		5		CSA WA NA EA	361
rs183241194^1,2		--	2579728(+)	`GTTCAC/GTGCAG`	1	--	int¹		0	--	--	--	--
rs77651117^1,2		--	2579757(+)	`AAACAG/ATCCTC`	1	--	int¹		4		CSA WA NA EA	360
rs150832524^1,2		--	2579850(+)	`TGAGCA/TATACT`	1	--	int¹		0	--	--	--	--
rs188955144^1,2		--	2579856(+)	`ATACTA/CCTGGG`	1	--	int¹		0	--	--	--	--
rs193086605^1,2		--	2579938(+)	`CTCCAC/TTGATC`	1	--	int¹		0	--	--	--	--
rs144602981^1,2	C,	--	2579941(+)	`TTGAT-/ACCCCC`	1	--	int¹		0	--	--	--	--
rs183568449^1,2		--	2580039(+)	`GAACCA/GGCTTC`	1	--	int¹		0	--	--	--	--
rs1061545^1,2	C,F,A,H,	--	2580070(-)	`CTGCCA/GCCACC`	1	--	int¹ ese³		21		NS EA NA WA CSA	2337
rs139408057^1,2		--	2580085(+)	`CACCAA/GAAGAC`	1	--	int¹		0	--	--	--	--
rs145704163^1,2		--	2580115(+)	`ATTTCC/TACATC`	1	--	int¹		0	--	--	--	--
rs6461429^1,2	C,F,A,H,	--	2580275(+)	`GGCACA/GTTCAC`	1	--	int¹		23		NS EA NA WA CSA	2348
rs188163691^1,2		--	2580291(+)	`GCGCTG/TAGGAG`	1	--	int¹		0	--	--	--	--
rs147747670^1,2		--	2580294(+)	`CTTAGC/GAGAAC`	1	--	int¹		0	--	--	--	--
rs191842793^1,2		--	2580334(+)	`GCCACC/GTCATT`	1	--	int¹		0	--	--	--	--
rs140871737^1,2		--	2580377(+)	`ACCAGC/TGCCCC`	1	--	int¹		0	--	--	--	--
rs115986733^1,2	C,F,	--	2580569(+)	`ACTGCC/TTCTGC`	1	--	int¹		1		WA	118
rs201855243^1,2		--	2580613(+)	`CGTACA/CGTGGG`	2	T	syn¹		0	--	--	--	--
rs200963118^1,2		--	2580698(+)	`CAGAGA/GTGAGT`	1	--	int¹		0	--	--	--	--
rs200112406^1,2		--	2580901(+)	`ATAGCC/TCCACG`	1	--	int¹		0	--	--	--	--
rs62442586^1,2	C,F,	--	2580914(+)	`AAAGCC/TGTACA`	1	--	int¹		5		NA EU	1359
rs141751133^1,2	C,F	--	2580935(+)	`ACCTGT/ACCCCT`	2	/T /S	mis¹		2		NA EU	5385
rs145506790^1,2	C,F,	--	2580948(+)	`GACAGC/AGTCCC`	2	/T	syn¹		1		NA	4206
rs138016332^1,2	C,F	--	2580962(+)	`GAAGTC/TGAGGG`	2	N D	mis¹		1		NA	4170
rs141807337^1,2	C,	--	2580986(+)	`CCGGAC/G/TGCAGC`	3	I L V	mis¹		1		NA	3894
rs202145442^1,2		--	2581001(+)	`CAGGGA/TCCCAC`	2	T S	mis¹		0	--	--	--	--
rs7807895^1,2	C,F,	--	2581047(+)	`GAGCCG/ATCACA`	2	/D	syn¹ ese³		1		WA	118
rs191610171^1,2		--	2581050(+)	`CCGTCA/GCAGAG`	2	C	syn¹		0	--	--	--	--
rs201141165^1,2		--	2581089(+)	`AGAGAC/TGCCTG`	2	A	syn¹		0	--	--	--	--
rs185653171^1,2	C,	--	2581101(+)	`GGCCAC/TGGTGA`	2	P	syn¹		0	--	--	--	--
rs113613637^1,2	C,	--	2581126(+)	`GCGAGG/TAAGAG`	1	--	int¹		2		WA	120
rs200404455^1,2		--	2581151(+)	`GTTGCA/GGTCCC`	1	--	int¹		0	--	--	--	--
rs199509441^1,2		--	2581334(+)	`CATGAA/GGACCG`	1	--	int¹		0	--	--	--	--
rs139472984^1,2	F	--	2581387(+)	`GGTGCG/AGCACA`	2	/R /C	mis¹		1		NA	3816
rs144499760^1,2	C,F	--	2581447(+)	`GGCATC/TGTCTG`	2	N D	mis¹		1		NA	4416
rs117866045^1,2	F,	--	2581579(+)	`TGCAGA/GGCAGC`	1	--	int¹		1		NA	120
rs143433581^1,2		--	2581662(+)	`GGGGCA/GGGGGT`	1	--	int¹		0	--	--	--	--
rs115083971^1,2	F,	--	2581684(+)	`TACTCT/CCATCC`	1	--	int¹		1		WA	118
rs190525508^1,2		--	2581703(+)	`TCCCCC/TAGCCG`	1	--	int¹		0	--	--	--	--
rs201628162^1,2		--	2581708(+)	`CAGCCA/GCAGGG`	1	--	int¹		0	--	--	--	--
rs76646873^1,2	C,F,	--	2581776(+)	`TGAACC/TGTGGC`	2	T	syn¹		3		WA NA EU	2715
rs181738663^1,2	C,	--	2581806(+)	`GGCTGC/GAGAAG`	2	L	syn¹		0	--	--	--	--
rs150942467^1,2	C,F,	--	2581807(+)	`GCTGGA/CGAAGG`	2	R L	mis¹		2		NA EU	3093
rs140903769^1,2	C,F,	--	2581814(+)	`AAGGAC/TCTGGA`	2	I V	mis¹		1		NA	2698
rs73287544^1,2	C,	--	2581858(+)	`CAAACG/ACGAGG`	1	--	int¹		2		WA	120
rs113638677^1,2	C,	--	2581859(+)	`AAACGC/TGAGGT`	1	--	int¹		2		CSA WA	120
rs3735104^1,2	C,F,	--	2581994(+)	`GGGGAT/CGCCAT`	1	--	int¹ ese³		11		EA NA WA CSA EU	1948
rs144837082^1,2		--	2582040(+)	`GAGATA/GGGCCT`	1	--	int¹		0	--	--	--	--
rs7778352^1,2	C,F,A,	--	2582153(+)	`GGGTGC/TCCCCA`	1	--	int¹		3		NA CSA	5
rs138295649^1,2	C,	--	2582153(+)	`GGTGC-/CCCCAGCC TCCCGGGTGTCCCCA`	1	--	int¹		0	--	--	--	--
rs11274844^1,2	C	--	2582159(+)	`CCCAGCCTCCCGGGT GTCCCCAG/-GTGTG`	1	--	int¹		1		NA	2
rs80058774^1,2	C	--	2582160(+)	`CCCAGC/GTGTGT`	1	--	int¹		0	--	--	--	--
rs3735105^1,2	C,F,H,	--	2582200(+)	`CCTCAC/GGTCTG`	1	--	int¹ ese³		8		EA NS WA	2146
rs3735106^1,2	C,F,	--	2582233(+)	`CCACAA/GTGCAT`	1	--	int¹ ese³		13		EA NA WA CSA EU	2380
rs61673178^1,2	C,F,	--	2582381(+)	`CCCTAT/ATGTGA`	1	--	int¹		9		NA WA CSA EA EU	895
rs6972204^1,2	C,F,H,	--	2582452(+)	`TGCCGT/CTGCAC`	1	--	int¹ ese³		11		NS EA NA CSA WA EU	1041
rs141709433^1,2		--	2582685(+)	`CCGCGC/TGCAAC`	1	--	int¹		0	--	--	--	--
rs200077117^1,2		--	2582807(+)	`CACCCA/GCCTCG`	1	--	int¹		0	--	--	--	--
rs201838403^1,2		--	2582811(+)	`CGCCTC/TGGAAT`	1	--	int¹		0	--	--	--	--
rs201041622^1,2	C,	--	2582877(+)	`GTCCCA/TTGTGG`	2	K M	mis¹		0	--	--	--	--
rs151317339^1,2	C,F	--	2582878(+)	`TCCCAT/CGTGGG`	2	/M /V	mis¹		2		NA EU	5711
rs140451075^1,2	C,F,	--	2582895(+)	`CCAGGC/GAGCTC`	2	S C	mis¹		2		NA EU	5695
rs77213198^1,2	C,F,	--	2582907(+)	`GAGCCC/TGCGCC`	2	Q R	mis¹		3		EA NA EU	5843
rs146546197^1,2	C,F	--	2582935(+)	`GCCGTC/TGGAAG`	2	N D	mis¹		1		NA	4460
rs141320181^1,2	F	--	2582936(+)	`CCGTCG/AGAAGA`	2	/S	syn¹		1		NA	4464
rs201793719^1,2		--	2582974(+)	`CCCCAG/TAGAGA`	1	--	int¹		0	--	--	--	--
rs201155141^1,2		--	2582977(+)	`CAGAGA/GGAAAA`	1	--	int¹		0	--	--	--	--
rs201715454^1,2	F	--	2583011(+)	`CCATTC/TGAGGC`	1	--	int¹		1		EU	1291
rs13240450^1,2	C,F,	--	2583165(+)	`TGGGCG/ATTATC`	1	--	int¹ ese³		4		NA EU	688
rs77887835^1,2	C,F,	--	2583196(+)	`CCAGGC/TCCCCC`	1	--	int¹		2		NA EU	1418
rs150359205^1,2	C,	--	2583213(+)	`GTCCCA/GGGGCC`	1	--	int¹		0	--	--	--	--
rs145047426^1,2	C	--	2583225(+)	`TGACCG/AAGCCA`	2	/R /C	mis¹		1		NA	2940
rs149503475^1,2	C	--	2583264(+)	`TGCGGC/TGGGGA`	2	T A	mis¹		1		NA	3508
rs143192367^1,2	C,	--	2583265(+)	`GCGGCG/AGGGAT`	2	/P	syn¹		1		NA	3586
rs148261595^1,2	C,F,	--	2583299(+)	`CCACGC/TGGGGA`	2	H R	mis¹		1		NA	4156
rs61753095^1,2	C,F,	--	2583328(+)	`GCTTCC/TGTCCA`	2	T	syn¹		4		NA EU	5281
rs138784645^1,2		--	2583329(+)	`CTTCCA/GTCCAG`	2	T M	mis¹		0	--	--	--	--
rs79263074^1,2	C,	--	2583348(+)	`GCAGCA/GCCCGA`	2	R C	mis¹		0	--	--	--	--
rs139443843^1,2	C,F,	--	2583352(+)	`CGCCCG/AAAGGT`	2	/F	syn¹		1		NA	4422
rs144841598^1,2	C	--	2583449(+)	`CACACG/ACGGGC`	2	/A /V	mis¹		1		NA	4412
rs148598276^1,2	C,F	--	2583482(+)	`GCTGCC/TCCTCG`	2	E G	mis¹		1		NA	4322
rs140833277^1,2	C,F	--	2583593(+)	`CGACCG/ACACCT`	2	/A /V	mis¹		1		NA	2726
rs199745325^1,2	C,	--	2583596(+)	`CCGCAC/TCTGGG`	2	D G	mis¹		0	--	--	--	--
rs201479460^1,2		--	2583618(+)	`GGAAGA/GGAGGG`	1	--	int¹		0	--	--	--	--
rs11267702^1,2	C,	--	2583657(+)	`GGGAG-/GCAGAGGGCCTCA GGGAAGATACAAATAGCAGA`	1	--	int¹		0	--	--	--	--
rs147960160^1,2	C,	--	2583692(+)	`GAGGG-/CCCCCC`	1	--	int¹		0	--	--	--	--
rs144673038^1,2		--	2583700(+)	`CCCCAA/GGATGC`	1	--	int¹		0	--	--	--	--
rs181229004^1,2		--	2583779(+)	`CTCCCC/GCCGAG`	1	--	int¹		0	--	--	--	--
rs148497258^1,2		--	2583796(+)	`ACACAA/CACAGC`	1	--	int¹		0	--	--	--	--
rs201500695^1,2		--	2583831(+)	`TCTTG-/TTTGTT`	1	--	int¹		0	--	--	--	--
rs114533867^1,2	C	--	2583834(+)	`TTGTTG/TTTTTT`	1	--	int¹		0	--	--	--	--
rs79906321^1,2	C	--	2583870(+)	`CTTGTC/TCTGTT`	1	--	int¹		0	--	--	--	--
rs78073914^1,2	C	--	2583878(+)	`GTTGCA/CCAGGG`	1	--	int¹		0	--	--	--	--
rs184886521^1,2		--	2583899(+)	`TGGTGC/TGATCT`	1	--	int¹		0	--	--	--	--
rs189695369^1,2		--	2584189(+)	`GAGTGC/GAGTGG`	1	--	int¹		0	--	--	--	--
rs180980098^1,2		--	2584203(+)	`AACCAC/TTGCTC`	1	--	int¹		0	--	--	--	--
rs187291856^1,2		--	2584265(+)	`GAGTAA/GCTGGG`	1	--	int¹		0	--	--	--	--
rs192044286^1,2		--	2584416(+)	`TGTCAA/CAGTGC`	1	--	int¹		0	--	--	--	--
rs34720091^1,2	C,	--	2584523(+)	`TGGGGT/CGGGGT`	1	--	int¹		2		NA	122
rs183545975^1,2		--	2584549(+)	`ATGGTC/TGGCCA`	2	N D	mis¹		0	--	--	--	--
rs138585448^1,2	C,F	--	2584612(+)	`GCCGCT/GGCGCA`	2	/S /R	mis¹		1		NA	2744
rs200605265^1,2		--	2584628(+)	`GGGACA/GGCCCA`	2	A	syn¹		0	--	--	--	--
rs147005619^1,2	C	--	2584692(+)	`CCTGCT/AGGGAA`	1	--	spa¹		1		NA	2852
rs144804514^1,2		--	2584765(+)	`GAGGCC/TGAGGA`	1	--	int¹		0	--	--	--	--
rs190068402^1,2		--	2584922(+)	`GAACCC/TGGGAG`	1	--	int¹		0	--	--	--	--
rs151307068^1,2		--	2584929(+)	`GGAGGC/TGAAGG`	1	--	int¹		0	--	--	--	--
rs182675093^1,2		--	2584952(+)	`AAGATC/TGCACC`	1	--	int¹		0	--	--	--	--
rs187324552^1,2		--	2584984(+)	`CACAGC/GGAGAC`	1	--	int¹		0	--	--	--	--
rs139089190^1,2		--	2585108(+)	`GATACC/TTCTGG`	1	--	int¹		0	--	--	--	--
rs200027603^1,2		--	2585121(+)	`ACACT-/TTCTTCTT`	1	--	int¹		0	--	--	--	--
rs200948320^1,2		--	2585132(+)	`TTCTT-/CTTTTT`	1	--	int¹		0	--	--	--	--
rs62442588^1,2	C,F,	--	2585154(+)	`CAGTCC/TCACTC`	1	--	int¹		4		NA CSA	125
rs191369297^1,2		--	2585532(+)	`TGCCTC/GGGTGG`	1	--	int¹		0	--	--	--	--
rs117120705^1,2	F,	--	2585570(+)	`CTGGGG/AGGCAT`	1	--	int¹		1		EA	120
rs149894630^1,2		--	2585573(+)	`GGGGGC/TATCGT`	1	--	int¹		0	--	--	--	--
rs144950362^1,2		--	2585623(+)	`CCTGGC/TGAGGG`	1	--	int¹		0	--	--	--	--
rs140774072^1,2		--	2585781(+)	`TGCTAC/TGTAGA`	1	--	int¹		0	--	--	--	--
rs184466418^1,2		--	2585783(+)	`CTATGC/TAGAAA`	1	--	int¹		0	--	--	--	--
rs188944045^1,2		--	2585787(+)	`GTAGAA/GATTCT`	1	--	int¹		0	--	--	--	--
rs144613079^1,2		--	2585841(+)	`AGGCCA/GAGGCA`	1	--	int¹		0	--	--	--	--
rs193114513^1,2		--	2585854(+)	`ATGATC/TGCTTG`	1	--	int¹		0	--	--	--	--
rs146751772^1,2		--	2585924(+)	`AACAAA/TGTTAG`	1	--	int¹		0	--	--	--	--
rs4721775^1,2	C,F,A,H,	--	2585930(+)	`gttagC/Tcaggt`	1	--	int¹		10		NS EA NA	668
rs116527133^1,2	F,	--	2586044(+)	`CTGGAC/TGACAG`	1	--	int¹		1		WA	118
rs185117717^1,2		--	2586051(+)	`ACAGAA/GCAGGA`	1	--	int¹		0	--	--	--	--
rs6961078^1,2	C,A,	--	2586095(+)	`GGGTAT/AGGTGG`	1	--	int¹		1		WA	2
rs143550225^1,2		--	2586105(+)	`GCTCAC/TGCCTG`	1	--	int¹		0	--	--	--	--
rs148044391^1,2		--	2586106(+)	`CTCACA/GCCTGT`	1	--	int¹		0	--	--	--	--
rs141739600^1,2		--	2586155(+)	`TTGAGC/GTCAAG`	1	--	int¹		0	--	--	--	--
rs150416603^1,2		--	2586161(+)	`TCAAGC/GAGTTC`	1	--	int¹		0	--	--	--	--
rs188946990^1,2		--	2586267(+)	`GGGAGA/GCTGAG`	1	--	int¹		0	--	--	--	--
rs181692157^1,2		--	2586303(+)	`GGTGGA/GGACTG`	1	--	int¹		0	--	--	--	--
rs183946095^1,2		--	2586323(+)	`GAGTTC/TGAACC`	1	--	int¹		0	--	--	--	--
rs115977879^1,2	F,	--	2586415(+)	`TTTTTT/AAAAAA`	1	--	int¹		1		WA	118
rs733137^1,2	C,F,A,H,	--	2586416(-)	`TTTTTT/AAAAAA`	1	--	int¹ trp³		5		WA CSA NA EA	362
rs138410612^1,2		--	2586472(+)	`ATTTGC/TAGGCT`	1	--	int¹		0	--	--	--	--
rs188672997^1,2		--	2586473(+)	`TTTGTA/GGGCTG`	1	--	int¹		0	--	--	--	--
rs143796245^1,2		--	2586499(+)	`AGGATA/GTGCGG`	1	--	int¹		0	--	--	--	--
rs147253903^1,2		--	2586503(+)	`TGTGCA/GGTCTC`	1	--	int¹		0	--	--	--	--
rs180752698^1,2		--	2586535(+)	`CACGGC/TGCAGC`	1	--	int¹		0	--	--	--	--
rs7459242^1,2	C,F,A,	--	2586574(+)	`GACGGG/AGGCCA`	1	--	int¹		6		NA WA EA	364
rs115520428^1,2	F,	--	2586580(+)	`GGCCAC/TGGGGC`	1	--	int¹		3		WA NA EA	358
rs2164689^1,2	C,F,	--	2586653(-)	`TGGGAC/TGGAGA`	1	--	int¹		7		NA CSA WA EA	365
rs114060228^1,2	F,	--	2586773(+)	`CACTCC/TGGGCG`	1	--	int¹		1		WA	118
rs12666641^1,2	C,H,	--	2586817(+)	`AAACAT/GGCAGT`	1	--	int¹		3		NA EA	124
rs192133446^1,2	C,	--	2586949(+)	`GGCCCC/TAGGCT`	1	--	int¹		0	--	--	--	--
rs148548421^1,2	C,F,	--	2587074(+)	`CTCCAC/G/TCAGGC`	3	M L V	mis¹		1		NA	4540
rs2164688^1,2	C,F,A,H,	--	2587122(-)	`GGGCCA/GTCCCC`	1	--	int¹		10		NA CSA WA EA EU	1615
rs6942871^1,2	C,F,A,H,	--	2587150(+)	`GGGTAC/TGGCAC`	1	--	int¹		20		NS EA NA WA CSA EU	3597
rs142936050^1,2		--	2587211(+)	`TTCTTG/TCAGGG`	1	--	int¹		0	--	--	--	--
rs182147987^1,2		--	2587255(+)	`ATCTGC/TAACAA`	1	--	int¹		0	--	--	--	--
rs201970214^1,2		--	2587387(+)	`AATGT-/TCTGTCT`	1	--	int¹		0	--	--	--	--
rs4721776^1,2	C,F,A,H,	--	2587613(+)	`ATTGGG/AAGGCT`	1	--	int¹		3		NA CSA	6
rs61349813^1,2		--	2587639(+)	`CTTGAC/ACCTGG`	1	--	int¹		1		CSA	2
rs117912207^1,2	F,	--	2587664(+)	`AGTGAG/CCCAAG`	1	--	int¹		1		EA	120
rs187670455^1,2		--	2587707(+)	`TGGGCA/GACAGA`	1	--	int¹		0	--	--	--	--
rs57069903^1,2	C	--	2587728(+)	`AAAAA-/AAAA AAAAAAAGTGGA`	1	--	int¹		0	--	--	--	--
rs140396797^1,2		--	2587784(+)	`ACTTTG/TCCTTA`	1	--	int¹		0	--	--	--	--
rs149946270^1,2		--	2587876(+)	`GCTATC/TGCTCA`	1	--	int¹		0	--	--	--	--
rs145092097^1,2		--	2588057(+)	`GCTGGA/GTGAGG`	1	--	int¹		0	--	--	--	--
rs58609298^1,2	C,	--	2588157(+)	`TAGCCC/TGGCAT`	1	--	int¹		3		WA EA	240
rs190604577^1,2		--	2588158(+)	`AGCCCA/GGCATG`	1	--	int¹		0	--	--	--	--
rs6461440^1,2	C,A,	--	2588281(+)	`GGCGAC/TAGAGG`	1	--	int¹		2		CSA EA	122
rs12534094^1,2	C,H,	--	2588323(+)	`GGGGCA/GTGGTG`	1	--	int¹		0	--	--	--	--
rs143139650^1,2		--	2588377(+)	`AGATCA/GCGAGG`	1	--	int¹		0	--	--	--	--
rs183158044^1,2		--	2588378(+)	`GATCAC/TGAGGT`	1	--	int¹		0	--	--	--	--
rs7804517^1,2	C,	--	2588551(+)	`CCGAGC/ATCGCA`	1	--	int¹		1		CSA	2
rs146355190^1,2		--	2588581(+)	`TGACAA/GGGCAA`	1	--	int¹		0	--	--	--	--
rs6976415^1,2	C,F,H,	--	2588629(+)	`AACAAT/CGCCAC`	1	--	int¹		6		NA CSA WA EA	364
rs6951708^1,2	C,F,H,	--	2588630(+)	`ACAATG/CCCACT`	1	--	int¹		6		NA CSA WA EA	364
rs187085101^1,2		--	2588688(+)	`AGAATG/TAAAAT`	1	--	int¹		0	--	--	--	--
rs138994458^1,2		--	2588951(+)	`CCCCTA/CTCTAT`	1	--	int¹		0	--	--	--	--
rs190332355^1,2		--	2589002(+)	`GCTACA/CCTGGA`	1	--	int¹		0	--	--	--	--
rs182670357^1,2		--	2589421(+)	`CAGTAA/GGCAAA`	1	--	int¹		0	--	--	--	--
rs187623506^1,2		--	2589607(+)	`CTGGGA/CAACGT`	1	--	int¹		0	--	--	--	--
rs193206270^1,2		--	2589610(+)	`GGCAAC/TGTGGT`	1	--	int¹		0	--	--	--	--
rs141417232^1,2		--	2589691(+)	`ATCCAC/GGAGGC`	1	--	int¹		0	--	--	--	--
rs183847449^1,2		--	2589773(+)	`GCCTGA/GGTGAC`	1	--	int¹		0	--	--	--	--
rs138336112^1,2		--	2589778(+)	`AGTGAC/TAGAGT`	1	--	int¹		0	--	--	--	--
rs111799327^1,2	C,	--	2589798(+)	`AAAAG-/AGAAAA`	1	--	int¹		1		CSA	2
rs58187536^1,2	C	--	2589809(+)	`AAAAAA/-TGCCA`	1	--	int¹		1		NA	2
rs71026528^1,2	C	--	2590102(+)	`AAAAAA/-CAAAA`	1	--	int¹		2		NA	4
rs112705374^1,2	C	--	2590129(+)	`AAAAAG/AAAAGA`	1	--	int¹		1		WA	2
rs187909551^1,2		--	2590200(+)	`AAAATC/TATGAA`	1	--	int¹		0	--	--	--	--
rs4721781^1,2	C,F,H,	--	2590383(+)	`GTGAAC/TCCAGA`	1	--	int¹		26		NS EA NA WA CSA	2771
rs146132359^1,2		--	2590419(+)	`TTAGAC/TTGTGC`	1	--	int¹		0	--	--	--	--
rs139865308^1,2		--	2590507(+)	`CATGTC/TAGACG`	1	--	int¹		0	--	--	--	--
rs192019759^1,2		--	2590518(+)	`GGTCAC/GGTACC`	1	--	int¹		0	--	--	--	--
rs116384860^1,2	F,	--	2590565(+)	`ACATGC/TGCCTG`	1	--	int¹		1		WA	118
rs184422576^1,2		--	2590623(+)	`AACCCC/TAGCAC`	1	--	int¹		0	--	--	--	--
rs60865104^1,2		--	2590663(+)	`GAGGTT/CAGGAG`	1	--	int¹		1		CSA	1
rs146215608^1,2		--	2590733(+)	`GCCGGA/GCATGG`	1	--	int¹		0	--	--	--	--
rs6945417^1,2	C,	--	2590859(+)	`AACAGA/GGCAAG`	1	--	int¹		0	--	--	--	--
rs188426341^1,2		--	2590903(+)	`TATATA/GTATCT`	1	--	int¹		0	--	--	--	--
rs142520696^1,2		--	2590916(+)	`ATATAA/GATATA`	1	--	int¹		0	--	--	--	--
rs192731571^1,2		--	2590921(+)	`GATATA/GTATAT`	1	--	int¹		0	--	--	--	--
rs200192251^1,2		--	2591161(+)	`TCTAT-/GGGGAA`	1	--	int¹		0	--	--	--	--
rs4719568^1,2	C,F,A,	--	2591165(+)	`ATGGGA/GAAAAA`	1	--	int¹ trp³		6		NA CSA WA EA	363
rs184272431^1,2		--	2591216(+)	`TCAAGA/GGAATG`	1	--	int¹		0	--	--	--	--
rs189166796^1,2		--	2591263(+)	`GAGCCG/TTGTTC`	1	--	int¹		0	--	--	--	--
rs181060476^1,2		--	2591264(+)	`AGCCGC/TGTTCA`	1	--	int¹		0	--	--	--	--
rs186392404^1,2		--	2591298(+)	`GACGCA/GCAAAA`	1	--	int¹		0	--	--	--	--
rs115580694^1,2	F,	--	2591555(+)	`CCATAT/CTTTGA`	1	--	int¹		1		WA	118
rs202073706^1,2		--	2591596(+)	`GGGTG-/AAAAAA`	1	--	int¹		0	--	--	--	--
rs200072214^1,2		--	2591621(+)	`AGCAT-/AAAATAC`	1	--	int¹		0	--	--	--	--
rs189581135^1,2		--	2591650(+)	`CCAAAA/GTACTG`	1	--	int¹		0	--	--	--	--
rs181513813^1,2		--	2591719(+)	`AAATAC/TATATA`	1	--	int¹		0	--	--	--	--
rs201102856^1,2		--	2591729(+)	`ATATA-/TATATA TATATATTTTTTT`	1	--	int¹		0	--	--	--	--
rs200339916^1,2		--	2591737(+)	`ATATA-/TAT ATTTTTTTTT`	1	--	int¹		0	--	--	--	--
rs6950657^1,2	C	--	2591738(+)	`TATATA/TTATTT`	1	--	int¹		0	--	--	--	--
rs186157516^1,2		--	2591813(+)	`ATGGCA/GTTATC`	1	--	int¹		0	--	--	--	--
rs190080897^1,2		--	2592033(+)	`AGGCAC/TGAACC`	1	--	int¹		0	--	--	--	--
rs150887655^1,2	C,	--	2592055(+)	`CTTAA-/ATATATA`	1	--	int¹		0	--	--	--	--
rs10633739^1,2	C	--	2592065(+)	`TATAT-/ATTAGAA`	1	--	int¹		0	--	--	--	--
rs151000255^1,2		--	2592073(+)	`GAAAAC/GAAGGA`	1	--	int¹		0	--	--	--	--
rs140901349^1,2		--	2592213(+)	`CAATAC/TAATTT`	1	--	int¹		0	--	--	--	--
rs149713337^1,2		--	2592243(+)	`GAACAC/TGGTAA`	1	--	int¹		0	--	--	--	--
rs114268003^1,2	F,	--	2592274(+)	`AATAGC/GAGAAA`	1	--	int¹		1		WA	118
rs147836087^1,2		--	2592340(+)	`CATGCA/GAGAAT`	1	--	int¹		0	--	--	--	--
rs142422301^1,2		--	2592474(+)	`TTCACA/GCCATT`	1	--	int¹		0	--	--	--	--
rs183010423^1,2		--	2592569(+)	`GAGACA/GGGGTT`	1	--	int¹		0	--	--	--	--
rs4721786^1,2	C,	--	2592599(+)	`GGTCTT/GGATCT`	1	--	int¹		2		NA	4
rs139166159^1,2		--	2592668(+)	`CCACCA/GCGCTC`	1	--	int¹		0	--	--	--	--
rs6956007^1,2	C,F,H,	--	2592679(+)	`GACTGA/CCACTA`	1	--	int¹		15		NS EA NA WA	1920
rs186744212^1,2		--	2592730(+)	`GGCACA/GATCTG`	1	--	int¹		0	--	--	--	--
rs190739837^1,2		--	2592806(+)	`GATTAC/TGGCGC`	1	--	int¹		0	--	--	--	--
rs182976904^1,2		--	2592821(+)	`CACCAA/TGCCCG`	1	--	int¹		0	--	--	--	--
rs187651744^1,2		--	2592944(+)	`ACAAGC/TATGAG`	1	--	int¹		0	--	--	--	--
rs192578001^1,2		--	2592954(+)	`GTCACC/TGCGCC`	1	--	int¹		0	--	--	--	--
rs80132656^1,2	C,	--	2592986(+)	`ATGATG/AAAAAA`	1	--	int¹		5		CSA WA NA EA	360
rs182754168^1,2		--	2593019(+)	`GTGGAA/GTGATT`	1	--	int¹		0	--	--	--	--
rs148920188^1,2		--	2593069(+)	`GTCAAC/TAACAT`	1	--	int¹		0	--	--	--	--
rs35394843^1,2	C,	--	2593157(+)	`CCTCA-/TTTTTT`	1	--	int¹		0	--	--	--	--
rs58859857^1,2	C	--	2593158(+)	`TTTTT-/TCCCCA`	1	--	int¹		0	--	--	--	--
rs201256086^1,2	C	--	2593167(+)	`TTTTTC/TCCCAG`	1	--	int¹		0	--	--	--	--
rs143675236^1,2		--	2593267(+)	`TTAAAC/GAACAT`	1	--	int¹		0	--	--	--	--
rs187396278^1,2		--	2593523(+)	`CAATCC/TGCTCG`	1	--	int¹		0	--	--	--	--
rs148161833^1,2		--	2593638(+)	`TACAAC/TGAGAA`	1	--	int¹		0	--	--	--	--
rs142034582^1,2		--	2593667(+)	`GTTCAC/TGCCTT`	1	--	int¹		0	--	--	--	--
rs11974537^1,2	C,F,A,H,	--	2593713(+)	`CTCAAC/TTGGCT`	1	--	int¹		30		NS EA NA WA CSA	3192
rs138928088^1,2		--	2593788(+)	`CCACAC/GATAAT`	1	--	int¹		0	--	--	--	--
rs142144615^1,2		--	2593822(+)	`TCTGAC/TTGGCA`	1	--	int¹		0	--	--	--	--
rs146203608^1,2		--	2593876(+)	`CTGCTA/CCCTGT`	1	--	int¹		0	--	--	--	--
rs200174537^1,2	C,F,	--	2594072(+)	`GTGAGG/ACCGCA`	1	--	ut5¹		1		EU	1193
rs201735473^1,2		--	2594100(+)	`GTGAGA/TGCCAA`	1	--	int¹		0	--	--	--	--
rs1866019^1,2	C,F,	--	2594181(-)	`CTGGGG/ACCCCT`	1	--	int¹		6		NA CSA WA EA	364
rs139100252^1,2		--	2594235(+)	`GGTCTG/TTACTG`	1	--	int¹		0	--	--	--	--
rs200394879^1,2		--	2594238(+)	`CTGTA-/CTGCAGGG`	1	--	int¹		0	--	--	--	--
rs149453489^1,2		--	2594287(+)	`CGCTGA/GTGGCG`	1	--	int¹		0	--	--	--	--
rs11773376^1,2	C,F,A,H,	--	2594338(+)	`GGCCTC/TCGGAA`	1	--	int¹		18		NS EA NA	1872
rs143887122^1,2		--	2594346(+)	`GAACTC/GAAAGT`	1	--	int¹		0	--	--	--	--
rs148689602^1,2		--	2594349(+)	`CTCAAA/CGTCTG`	1	--	int¹		0	--	--	--	--
rs144558259^1,2		--	2594370(+)	`TCTTTC/GGTGCA`	1	--	int¹		0	--	--	--	--
rs77163121^1,2	C,	--	2594440(+)	`TTGAGT/GTCCGG`	1	--	int¹		3		CSA WA EA	240
rs184725962^1,2		--	2594717(+)	`CTGCAC/TCTGAA`	1	--	int¹		0	--	--	--	--
rs189985842^1,2		--	2594788(+)	`AGGACC/GAGGTG`	1	--	int¹		0	--	--	--	--
rs192239565^1,2		--	2594932(+)	`GGCCGC/GGAGCG`	1	--	int¹		0	--	--	--	--
rs147851520^1,2		--	2594948(+)	`CCCGAA/GAGTCC`	1	--	int¹		0	--	--	--	--
rs2304542^1,2	C,F,	--	2594955(-)	`CCCTTC/TTGGAC`	1	--	int¹		2		WA EA	238
rs117219938^1,2	F,	--	2595132(+)	`GTTGCG/CTCCTC`	1	--	ut5¹		1		NA	120
rs183874963^1,2		--	2595269(+)	`AGCCTC/GGAGGG`	1	--	ut5¹		0	--	--	--	--
rs145252383^1,2		--	2595346(+)	`TCCGAC/GAGATC`	1	--	ut5¹		0	--	--	--	--
rs6960419^1,2	C,A,	--	2595406(+)	`GGGGCG/ATCTCG`	1	--	us2k¹		5		NA WA EA	362
rs79058325^1,2	C	--	2595417(+)	`AGGGCC/GGGGAT`	1	--	us2k¹		0	--	--	--	--
rs147899362^1,2		--	2595426(+)	`ATCTCC/TGAGGA`	1	--	us2k¹		0	--	--	--	--
rs117263800^1,2	F,	--	2595444(+)	`GGGTTG/CTGTCC`	1	--	us2k¹		1		NA	120
rs189333434^1,2		--	2595479(+)	`GGCGCC/GCAGTG`	1	--	us2k¹		0	--	--	--	--
rs74950049^1,2	C,	--	2595505(+)	`GAGAA-/AACTAT`	1	--	us2k¹		0	--	--	--	--
rs140514980^1,2		--	2595599(+)	`CCGCGC/TTGTGG`	1	--	us2k¹		0	--	--	--	--
rs181948860^1,2		--	2595653(+)	`GATTGC/TTTGAA`	1	--	us2k¹		0	--	--	--	--
rs150402623^1,2		--	2595769(+)	`TGTAAA/TCCCAG`	1	--	us2k¹		0	--	--	--	--
rs185908515^1,2		--	2595780(+)	`CGCTCC/TGGGAG`	1	--	us2k¹		0	--	--	--	--
rs58206210^1,2	C,F,	--	2595952(+)	`GAATCG/TCTTGA`	1	--	us2k¹		2		WA CSA	4
rs149141344^1,2		--	2595967(+)	`GGGAGA/GCGGAA`	1	--

Advanced Search

Export list of displayed genes

BRAT1 Gene

BRCA1-associated ATM activator 1

Aliases
for BRAT1 gene

Summaries
for BRAT1 gene

Genomic Views
for BRAT1 gene

Proteins
for BRAT1 gene

Protein Domains /
Families
for BRAT1 gene

Function
for BRAT1 gene

Pathways & Interactions
for BRAT1 gene

Drugs & Compounds
for BRAT1 gene

Transcripts
for BRAT1 gene

Expression
for BRAT1 gene

Orthologs
for BRAT1 gene

Paralogs
for BRAT1 gene

Genomic Variants
for BRAT1 gene

Advanced Search

Export list of displayed genes

BRAT1 Gene

BRCA1-associated ATM activator 1

Aliasesfor BRAT1 gene

Summariesfor BRAT1 gene

Genomic Viewsfor BRAT1 gene

Proteinsfor BRAT1 gene

Protein Domains /Familiesfor BRAT1 gene

Functionfor BRAT1 gene

Pathways & Interactionsfor BRAT1 gene

Drugs & Compoundsfor BRAT1 gene

Transcriptsfor BRAT1 gene

Expression for BRAT1 gene

Orthologsfor BRAT1 gene

Paralogsfor BRAT1 gene

Genomic Variantsfor BRAT1 gene

Aliases
for BRAT1 gene

Summaries
for BRAT1 gene

Genomic Views
for BRAT1 gene

Proteins
for BRAT1 gene

Protein Domains /
Families
for BRAT1 gene

Function
for BRAT1 gene

Pathways & Interactions
for BRAT1 gene

Drugs & Compounds
for BRAT1 gene

Transcripts
for BRAT1 gene

Expression
for BRAT1 gene

Orthologs
for BRAT1 gene

Paralogs
for BRAT1 gene

Genomic Variants
for BRAT1 gene