Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



ATXN10 Gene

protein-coding   GIFtS: 58
GCID: GC22P046067

Ataxin 10

(Previous name: spinocerebellar ataxia 10)
(Previous symbol: SCA10)
  See ATXN10-related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Ataxin 101 2     Spinocerebellar Ataxia 101
SCA101 2 3 5     E46L2
Brain Protein E46 Homolog2 3     HUMEEP2
Spinocerebellar Ataxia Type 10 Protein2 3     ataxin-102

External Ids:    HGNC: 105491   Entrez Gene: 258142   Ensembl: ENSG000001306387   OMIM: 6111505   UniProtKB: Q9UBB43   

Export aliases for ATXN10 gene to outside databases

Previous GC identifers: GC22P044388 GC22P029013


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for ATXN10 Gene:
This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis.
These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of a
pentanucleotide repeat in an intronic region of this locus has been associated with spinocerebellar ataxia, type
10. Alternatively spliced transcript variants have been described.(provided by RefSeq, Nov 2009)

GeneCards Summary for ATXN10 Gene:
ATXN10 (ataxin 10) is a protein-coding gene. Diseases associated with ATXN10 include spinocerebellar ataxia type 10, and spinocerebellar ataxia type10. GO annotations related to this gene include identical protein binding.

UniProtKB/Swiss-Prot: ATX10_HUMAN, Q9UBB4
Function: Necessary for the survival of cerebellar neurons (By similarity). Induces neuritogenesis by activating
the Ras-MAP kinase pathway (By similarity). May play a role in the maintenance of a critical intracellular
glycosylation level and homeostasis (By similarity)

Gene Wiki entry for ATXN10 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000022.10  NC_018933.2  NT_011520.13  
Regulatory elements:
   Regulatory transcription factor binding sites in the ATXN10 gene promoter:
         MEF-2A   Bach1   TBP   AML1a   aMEF-2   CUTL1   Nkx5-1   FOXL1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidATXN10 promoter sequence
   Search Chromatin IP Primers for ATXN10

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ATXN10


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 22q13.31   Ensembl cytogenetic band:  22q13.31   HGNC cytogenetic band: 22q13

ATXN10 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ATXN10 gene location

GeneLoc information about chromosome 22         GeneLoc Exon Structure

GeneLoc location for GC22P046067:  view genomic region     (about GC identifiers)

Start:
46,067,678 bp from pter      End:
46,241,187 bp from pter
Size:
173,510 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, and/or antibodies-online,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: ATX10_HUMAN, Q9UBB4 (See protein sequence)
Recommended Name: Ataxin-10  
Size: 475 amino acids; 53489 Da
Subunit: Homooligomer (By similarity). Interacts with OGT (By similarity). Interacts with GNB2. Interacts with
IQCB1
Secondary accessions: A6NLC4 B4DG05 O14998 O15009 Q6I9X4
Alternative splicing: 2 isoforms:  Q9UBB4-1   Q9UBB4-2   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for ATXN10: NX_Q9UBB4

Explore proteomics data for ATXN10 at MOPED

Post-translational modifications: 

  • Ubiquitination2 at Lys34, Lys56, Lys237, Lys262, Lys288, Lys371, Lys438, Lys452
  • Modification sites at PhosphoSitePlus

  • See ATXN10 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (2 alternative transcripts): 
    NP_001161093.1  NP_037368.1  

    ENSEMBL proteins: 
     ENSP00000252934   ENSP00000391117   ENSP00000414080   ENSP00000385624   ENSP00000370449  

    ATXN10 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Proteins for ATXN10
    OriGene Protein Over-expression Lysate for ATXN10
    OriGene Custom MassSpec
    OriGene Custom Protein Services for ATXN10
    GenScript Custom Purified and Recombinant Proteins Services for ATXN10
    Novus Biologicals ATXN10 Protein
    Novus Biologicals ATXN10 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for ATXN10

     
    Search eBioscience for Proteins for ATXN10 

     
    antibodies-online proteins for ATXN10 (7 products) 

     
    antibodies-online peptides for ATXN10

    ATXN10 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for ATXN10
    Novus Biologicals ATXN10 Antibodies
    Abcam antibodies for ATXN10
    Cloud-Clone Corp. Antibodies for ATXN10
    ThermoFisher Antibodies for ATXN10
    antibodies-online antibodies for ATXN10 (34 products) 

    ATXN10 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for ATXN10
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ATXN10
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for ATXN10
    Cloud-Clone Corp. CLIAs for ATXN10
    Search eBioscience for ELISAs for ATXN10 
    antibodies-online kits for ATXN10 (9 products) 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    ATXN: Ataxins

    3 InterPro protein domains:
     IPR011989 ARM-like
     IPR016024 ARM-type_fold
     IPR019156 Ataxin-10_domain

    Graphical View of Domain Structure for InterPro Entry Q9UBB4

    ProtoNet protein and cluster: Q9UBB4

    UniProtKB/Swiss-Prot: ATX10_HUMAN, Q9UBB4
    Similarity: Belongs to the ataxin-10 family


    Find genes that share domains with ATXN10           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: ATX10_HUMAN, Q9UBB4
    Function: Necessary for the survival of cerebellar neurons (By similarity). Induces neuritogenesis by activating
    the Ras-MAP kinase pathway (By similarity). May play a role in the maintenance of a critical intracellular
    glycosylation level and homeostasis (By similarity)

         Gene Ontology (GO): 3 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005488binding ----
    GO:0005515protein binding IPI16498633
    GO:0042802identical protein binding IEA--
         
    Find genes that share ontologies with ATXN10           About GenesLikeMe


    Phenotypes:
         2 GenomeRNAi human phenotypes for ATXN10:
     Decreased viability of wild-ty  Increased G2M DNA content 

    Animal Models:
       genOway: Develop your customized and physiologically relevant rodent model for ATXN10

    miRNA
    Products:
        
    miRTarBase miRNAs that target ATXN10:
    hsa-mir-155-5p (MIRT020830), hsa-mir-30a-5p (MIRT028592), hsa-mir-23b-3p (MIRT046248)

    Block miRNA regulation of human, mouse, rat ATXN10 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate ATXN10 (see all 43):
    hsa-miR-582-3p hsa-miR-2052 hsa-miR-4307 hsa-miR-19b-2* hsa-miR-3655 hsa-miR-25 hsa-miR-128 hsa-miR-16-1*
    SwitchGear 3'UTR luciferase reporter plasmidATXN10 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for ATXN10
    Predesigned siRNA for gene silencing in human, mouse, rat ATXN10

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ATXN10

    Clone
    Products:
         
    OriGene clones in human, mouse for ATXN10 (see all 11)
    OriGene ORF clones in mouse, rat for ATXN10
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): ATXN10 (NM_013236)
    Sino Biological Human cDNA Clone for ATXN10
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ATXN10
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ATXN10

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ATXN10
    Browse ESI BIO Cell Lines and PureStem Progenitors for ATXN10 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ATXN10


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    ATX10_HUMAN, Q9UBB4: Cytoplasm, perinuclear region
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    cytosol2
    mitochondrion2
    nucleus1

    Gene Ontology (GO): Selected cellular component terms (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005615extracellular space IDA--
    GO:0005737cytoplasm IDA--
    GO:0005829cytosol IEA--
    GO:0005886plasma membrane IDA--
    GO:0030425dendrite IDA15201271

    Find genes that share ontologies with ATXN10           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    2 Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for ATXN10
        Akt Signaling
    Parkinson's Disease Pathway



        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for ATXN10
    Interactions:

        Search GeneGlobe Interaction Network for ATXN10

    STRING Interaction Network Preview (showing 5 interactants - click image to see 20)

    Selected Interacting proteins for ATXN10 (Q9UBB43 ENSP000002529344) via UniProtKB, MINT, STRING, and/or I2D (see all 28)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    BSGP356133, ENSP000003337694I2D: score=2 STRING: ENSP00000333769
    MAGED1Q9Y5V33, ENSP000003648474I2D: score=2 STRING: ENSP00000364847
    STYXL1Q9Y6J83, ENSP000002486004I2D: score=2 STRING: ENSP00000248600
    C20orf24Q9BUV83, ENSP000003412134I2D: score=1 STRING: ENSP00000341213
    SAP18O004223, ENSP000003719734I2D: score=1 STRING: ENSP00000371973
    About this table

    Gene Ontology (GO): 3 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0007399nervous system development IMP16385455
    GO:0008219cell death IEA--
    GO:0031175neuron projection development IDA16498633

    Find genes that share ontologies with ATXN10           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for ATXN10 (ATX10)



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for ATXN10 gene (2 alternative transcripts): 
    NM_001167621.1  NM_013236.3  

    Unigene Cluster for ATXN10:

    Ataxin 10
    Hs.475125  [show with all ESTs]
    Unigene Representative Sequence: NM_013236
    11 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000252934(uc003bgm.2 uc011aqt.2 uc003bgn.2) ENST00000498009
    ENST00000470722 ENST00000476998 ENST00000483549 ENST00000435026 ENST00000493643
    ENST00000451241 ENST00000464482 ENST00000402380 ENST00000381061
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat ATXN10 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate ATXN10 (see all 43):
    hsa-miR-582-3p hsa-miR-2052 hsa-miR-4307 hsa-miR-19b-2* hsa-miR-3655 hsa-miR-25 hsa-miR-128 hsa-miR-16-1*
    SwitchGear 3'UTR luciferase reporter plasmidATXN10 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for ATXN10
    Predesigned siRNA for gene silencing in human, mouse, rat ATXN10
    Clone
    Products:
         
    OriGene clones in human, mouse for ATXN10 (see all 11)
    OriGene ORF clones in mouse, rat for ATXN10
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): ATXN10 (NM_013236)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ATXN10
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ATXN10
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for ATXN10
    OriGene qSTAR qPCR primer pairs in human, mouse for ATXN10
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ATXN10
      QuantiTect SYBR Green Assays in human, mouse, rat ATXN10
      QuantiFast Probe-based Assays in human, mouse, rat ATXN10

    Additional mRNA sequence: 

    AF086923.1 AF119662.1 AK025734.1 AK095309.1 AK294348.1 AL050282.1 AL137374.1 BC007508.2 
    CR456568.1 CR457381.1 

    20 DOTS entries:

    DT.100880152  DT.456354  DT.100880156  DT.75109620  DT.95170888  DT.95323192  DT.100880150  DT.100880151 
    DT.120631131  DT.92447311  DT.100649620  DT.100732184  DT.100804958  DT.100880155  DT.100880163  DT.120631138 
    DT.92447307  DT.95170867  DT.95170885  DT.95170887 

    Selected AceView cDNA sequences (see all 561):

    BX356556 CB109406 CD365555 AI683298 BE744432 AA574351 BU184519 F02480 
    BQ013813 CR598064 AA903941 AL137374 BU628654 CN483289 CB142033 BX421346 
    AA911361 H55656 BX361030 BU848652 BQ063242 AI565041 CD518443 BM759216 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for ATXN10 (see all 10)    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10 ^ 11a · 11b ^ 12a · 12b ^ 13a · 13b ^ 14 ^ 15a · 15b ^ 16 ^ 17 ^ 18a ·
    SP1:        -     -     -                                                           -                       -     -     -     -           -     -               
    SP2:              -     -                                                           -                       -     -     -     -           -     -               
    SP3:                                                                                                                                      -     -               
    SP4:                                                  -                                                                                                         
    SP5:                                                                                                        -     -     -     -           -     -               

    ExUns: 18b · 18c · 18d
    SP1:                  
    SP2:                  
    SP3:                  
    SP4:                  
    SP5:                  


    ECgene alternative splicing isoforms for ATXN10

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    ATXN10 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TAGCTGGAAA
    ATXN10 Expression
    About this image


    ATXN10 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 18) fully expand
     
     Gonad (Reproductive System)
             Primordial Germ Cells Primitive Gonad
     
     Brain (Nervous System)
             Cerebral Cortex
     
     Bone (Muscoskeletal System)
             Bone Marrow
     
     Colon (Gastrointestinal Tract)
     
     Uterus (Reproductive System)
    ATXN10 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    ATXN10 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.475125

    UniProtKB/Swiss-Prot: ATX10_HUMAN, Q9UBB4
    Tissue specificity: Expressed in the central nervous system

        Custom PCR Arrays for ATXN10
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for ATXN10
    OriGene qSTAR qPCR primer pairs in human, mouse for ATXN10
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ATXN10
    QuantiTect SYBR Green Assays in human, mouse, rat ATXN10
    QuantiFast Probe-based Assays in human, mouse, rat ATXN10
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ATXN10

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for ATXN10 gene from Selected species (see all 14)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Atxn101 , 5 ataxin 101, 5 83.23(n)1
    82.95(a)1
      15 (40.32 cM)5
    541381  NM_016843.31  NP_058539.21 
     853363815 
    chicken
    (Gallus gallus)
    Aves ATXN101 ataxin 10 65.59(n)
    55.48(a)
      418245  XM_416469.4  XP_416469.2 
    lizard
    (Anolis carolinensis)
    Reptilia ATXN106
    ataxin 10
    51(a)
    1 ↔ 1
    5(83718726-83824335)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.63732 Xenopus laevis transcribed sequence with weak similarity more 73.8(n)    AW633068.1 
    zebrafish
    (Danio rerio)
    Actinopterygii atxn101 ataxin 10 51.86(n)
    40.4(a)
      100034473  NM_001130612.1  NP_001124084.1 
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes CTR86(YCR054C)4 Essential protein of unknown function; with orthologs more   --   3(220067-218376) 850421  NP_009983.1 


    ENSEMBL Gene Tree for ATXN10 (if available)
    TreeFam Gene Tree for ATXN10 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for ATXN10 gene
    1 SIMAP similar gene for ATXN10 using alignment to 4 protein entries:     ATX10_HUMAN (see all proteins):
    DKFZp434I1726

    Find genes that share paralogs with ATXN10           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for ATXN10 (see all 3628)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 22 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1381461,2
    C--29047991(+) TGTTTATTTTCTAAATGTCCT
    TTTGTTACGGTTTT
    /-
    CTAAT
    2 -- cds11Minor allele frequency- -:0.00NA 2
    rs753230481,2
    C--29084124(+) CCCCCC/TTTGGG 2 -- int11Minor allele frequency- T:0.50CSA 2
    rs2018315021,2
    C--29084126(-) TTCCCA/CAGGGG 2 -- int10--------
    rs351000131,2
    C--29094487(+) TTTTTT/-CTGTC 2 -- int11Minor allele frequency- -:0.00NA 2
    rs1822092461,2
    --29982589(+) GGAATA/GTTTTT 2 -- us2k10--------
    rs1856398761,2
    --29982719(+) TGCAAC/TGTGTG 2 -- us2k10--------
    rs1348581,2
    C,F,A,H--29982845(+) GACTGG/ATCTTG 2 -- us2k14Minor allele frequency- A:0.43NA WA CSA 7
    rs1348591,2
    C,F,A,H--29982922(+) ACCGTG/CTCTGG 2 -- us2k110Minor allele frequency- C:0.37NA WA CSA EA 370
    rs1881500941,2
    --29983081(+) ACCTGC/GCACAT 2 -- us2k10--------
    rs57655721,2
    C,F,H--29983144(+) AAACTG/AAATGA 2 -- us2k17Minor allele frequency- A:0.11NS EA NA 544

    HapMap Linkage Disequilibrium report for ATXN10 (46067678 - 46241187 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 6 variations for ATXN10:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2724410CNV Deletion23290073
    nsv915300CNV Loss21882294
    nsv915299CNV Loss21882294
    dgv5004n71CNV Loss21882294
    nsv527209CNV Loss19592680
    dgv73n68CNV Gain17160897

    Human Gene Mutation Database (HGMD): ATXN10
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing ATXN10
    DNA2.0 Custom Variant and Variant Library Synthesis for ATXN10

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 611150   
    OMIM disorders: 603516  
    UniProtKB/Swiss-Prot: ATX10_HUMAN, Q9UBB4
  • Spinocerebellar ataxia 10 (SCA10) [MIM:603516]: Spinocerebellar ataxia is a clinically and genetically
    heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor
    coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement
    of the brainstem and spinal cord. SCA10 is an autosomal dominant cerebellar ataxia (ADCA). Note=The disease is
    caused by mutations affecting the gene represented in this entry
  • Note=Defects in ATXN1 may be a cause of nephronophthisis a chronic tubulo-interstitial nephropathy taht
    leads to anemia, polyuria, polydipsia, isosthenuria and death in uremia

  • 4 diseases for ATXN10:    
    About MalaCards
    spinocerebellar ataxia type 10    spinocerebellar ataxia type10    spinocerebellar ataxia    ataxia

    3 diseases from the University of Copenhagen DISEASES database for ATXN10:
    Spinocerebellar ataxia     Cerebellar ataxia     dentatorubral-pallidoluysian atrophy

    Find genes that share disorders with ATXN10           About GenesLikeMe

    2 Novoseek inferred disease relationships for ATXN10 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    spinocerebellar ataxias 93.3 11 15201271 (1), 15505178 (1), 17846122 (1), 18386626 (1) (see all 9)
    neurodegenerative diseases 61.3 4 15201271 (1), 18386626 (1), 19198092 (1)

    GeneTests: ATXN10
    GeneReviews: ATXN10
    Genetic Association Database (GAD): ATXN10
    Human Genome Epidemiology (HuGE) Navigator: ATXN10 (3 documents)

    Export disorders for ATXN10 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for ATXN10 gene, integrated from 10 sources (see all 61):
    (articles sorted by number of sources associating them with ATXN10)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Ataxin 10 induces neuritogenesis via interaction with G-protein beta2 subunit. (PubMed id 16498633)1, 2, 9 Waragai M.... Ashizawa T. (J. Neurosci. Res. 2006)
    2. Large expansion of the ATTCT pentanucleotide repeat in spinocerebellar ataxia type 10. (PubMed id 11017075)1, 2, 9 Matsuura T....Ashizawa T. (Nat. Genet. 2000)
    3. Ataxin-10, the spinocerebellar ataxia type 10 neurodegenerative disorder protein, is essential for survival of cerebellar neurons. (PubMed id 15201271)1, 2, 9 Maerz P....Ozbek S. (J. Biol. Chem. 2004)
    4. Mapping the NPHP-JBTS-MKS protein network reveals ciliopathy disease genes and pathways. (PubMed id 21565611)1, 2 Sang L.... Jackson P.K. (Cell 2011)
    5. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (Mol. Med. 2010)
    6. The genetic aetiology of late-onset chronic progressive cerebellar ataxia. A population-based study. (PubMed id 19259763)1, 4 Wardle M....Robertson N.P. (J. Neurol. 2009)
    7. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)
    8. Molecular genetics of hereditary spinocerebellar ataxia: mutation analysis of spinocerebellar ataxia genes and CAG/CTG repeat expansion detection in 225 Italian families. (PubMed id 15148151)1, 4 Brusco A....Taroni F. (Arch. Neurol. 2004)
    9. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    10. A genome annotation-driven approach to cloning the human ORFeome. (PubMed id 15461802)1, 2 Collins J.E.... Dunham I. (Genome Biol. 2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 25814 HGNC: 10549 AceView: ATXN10 Ensembl:ENSG00000130638 euGenes: HUgn25814
    ECgene: ATXN10 H-InvDB: ATXN10

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for ATXN10 Pharmacogenomics, SNPs, Pathways
    GeneReviewshttp://www.ncbi.nlm.nih.gov/books/NBK1116/?term=ATXN10[genesymbol]

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for ATXN10 gene:
    Search GeneIP for patents involving ATXN10

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for ATXN10  
     OriGene qPCR primer pairs and template standards for ATXN10   OriGene Protein Over-expression Lysate for ATXN10  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for ATXN10  
     OriGene qSTAR qPCR primer pairs in human, mouse for ATXN10   OriGene Purified Protein for ATXN10  
     OriGene ORF clones in mouse, rat for ATXN10   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ATXN10   OriGene Custom Protein Services for ATXN10  

     
     
     Block miRNA regulation of human, mouse, rat ATXN10 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing ATXN10
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ATXN10 Predesigned siRNA for gene silencing in human, mouse, rat ATXN10
     QuantiFast Probe-based Assays in human, mouse, rat ATXN10 QuantiTect SYBR Green Assays in human, mouse, rat ATXN10
     Custom PCR Arrays for ATXN10 Search Chromatin IP Primers for ATXN10
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ATXN10  Search GeneGlobe Interaction Network for ATXN10
     Regulatory tfbs in ATXN10 promoter
     GenScript Custom Purified and Recombinant Proteins Services for ATXN10 GenScript cDNA clones with any tag delivered in your preferred vector for ATXN10
     GenScript Custom Assay Services for ATXN10 GenScript Custom overexpressing Cell Line Services for ATXN10
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for ATXN10 (ATX10)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for ATXN10
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     ATXN10 antibodies
     ATXN10 proteins
     ATXN10 lysates
     Antibodies for ATXN10
     See all of Abcam's Antibodies, Kits and Proteins for ATXN10
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for ATXN10
     Antibodies for ATXN10
     ELISAs for ATXN10
     CLIAs for ATXN10



     Browse ESI BIO Cell Lines and PureStem Progenitors for ATXN10
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ATXN10
     SwitchGear 3'UTR luciferase reporter plasmids for ATXN10
     SwitchGear Promoter luciferase reporter plasmids for ATXN10
     ThermoFisher Antibodies for ATXN10
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ATXN10
     Browse compounds at ApexBio
     Search Addgene for plasmids for ATXN10
      Search eBioscience for proteins for ATXN10
      Search eBioscience for elisas for ATXN10
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for ATXN10
     antibodies-online antibodies for ATXN10 (34 products)
     antibodies-online kits for ATXN10 (9 products)
     antibodies-online peptides for ATXN10
     antibodies-online proteins for ATXN10 (7 products)
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 7 Oct 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ATXN10 gene at Home site.
    Version: 3.12.250 16 Nov 2014
    hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4