Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ATXN10 Gene

Aliases for ATXN10 Gene

  • Ataxin 10 2 3 5
  • Spinocerebellar Ataxia Type 10 Protein 3 4
  • Brain Protein E46 Homolog 3 4
  • SCA10 3 4
  • Spinocerebellar Ataxia 10 2
  • Ataxin-10 3
  • HUMEEP 3
  • E46L 3

External Ids for ATXN10 Gene

Previous HGNC Symbols for ATXN10 Gene

  • SCA10

Previous GeneCards Identifiers for ATXN10 Gene

  • GC22P044388
  • GC22P046067
  • GC22P029013

Summaries for ATXN10 Gene

Entrez Gene Summary for ATXN10 Gene

  • This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]

GeneCards Summary for ATXN10 Gene

ATXN10 (Ataxin 10) is a Protein Coding gene. Diseases associated with ATXN10 include Spinocerebellar Ataxia 10 and Autosomal Dominant Cerebellar Ataxia. Among its related pathways are Akt Signaling and Chks in Checkpoint Regulation. Gene Ontology (GO) annotations related to this gene include identical protein binding and binding.

UniProtKB/Swiss-Prot for ATXN10 Gene

  • Necessary for the survival of cerebellar neurons. Induces neuritogenesis by activating the Ras-MAP kinase pathway. May play a role in the maintenance of a critical intracellular glycosylation level and homeostasis.

Gene Wiki entry for ATXN10 Gene

Additional gene information for ATXN10 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ATXN10 Gene

Genomics for ATXN10 Gene

GeneHancer (GH) Regulatory Elements for ATXN10 Gene

Promoters and enhancers for ATXN10 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH22I045670 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 568.2 +1.0 999 3.7 HDGF PKNOX1 ATF1 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF121 POLR2B ATXN10 PRR34-AS1 GC22M045674 ENSG00000280383
GH22I046049 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 21.1 +400.9 400942 45.7 HDGF PKNOX1 FOXA2 SMAD1 ZFP64 SIN3A FEZF1 ZNF2 IRF4 YY1 LOC642648 PRR34 CDPF1 TRMU LINC00899 ATXN10 ENSG00000273243 ENSG00000273287 FAM118A TTC38
GH22I046006 Promoter/Enhancer 2.2 FANTOM5 Ensembl ENCODE dbSUPER 11.2 +338.9 338943 9.5 HDGF PKNOX1 FOXA2 ARID4B SIN3A DMAP1 ZNF2 YY1 POLR2B ZNF213 LINC00899 CDPF1 TRMU ENSG00000273243 LOC642648 PRR34-AS1 PRR34 MIRLET7BHG ENSG00000231010 NUP50
GH22I045638 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 16 -32.7 -32698 1.6 SIN3A DMAP1 ZNF48 FOS ATF7 DEK REST SMARCB1 ZNF592 KAT8 ATXN10 LOC105373067 GC22P045635
GH22I045678 Enhancer 1.2 Ensembl ENCODE dbSUPER 17.6 +9.9 9932 6.9 PKNOX1 BATF KLF5 IRF4 ZNF366 SCRT2 ZNF143 FOS IKZF2 RUNX3 ATXN10 TRMU LOC642648 LINC01589 CDPF1 GC22M045674 ENSG00000280383
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ATXN10 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ATXN10 gene promoter:

Genomic Locations for ATXN10 Gene

Genomic Locations for ATXN10 Gene
chr22:45,671,798-45,845,307
(GRCh38/hg38)
Size:
173,510 bases
Orientation:
Plus strand
chr22:46,067,678-46,241,187
(GRCh37/hg19)

Genomic View for ATXN10 Gene

Genes around ATXN10 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ATXN10 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ATXN10 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ATXN10 Gene

Proteins for ATXN10 Gene

  • Protein details for ATXN10 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9UBB4-ATX10_HUMAN
    Recommended name:
    Ataxin-10
    Protein Accession:
    Q9UBB4
    Secondary Accessions:
    • A6NLC4
    • B4DG05
    • O14998
    • O15009
    • Q6I9X4

    Protein attributes for ATXN10 Gene

    Size:
    475 amino acids
    Molecular mass:
    53489 Da
    Quaternary structure:
    • Homooligomer (By similarity). Interacts with OGT (By similarity). Interacts with GNB2. Interacts with IQCB1.

    Alternative splice isoforms for ATXN10 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ATXN10 Gene

Post-translational modifications for ATXN10 Gene

  • Ubiquitination at Lys34, posLast=5656, Lys237, posLast=262262, Lys288, posLast=371371, posLast=438438, and Lys452

Other Protein References for ATXN10 Gene

No data available for DME Specific Peptides for ATXN10 Gene

Domains & Families for ATXN10 Gene

Gene Families for ATXN10 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for ATXN10 Gene

Graphical View of Domain Structure for InterPro Entry

Q9UBB4

UniProtKB/Swiss-Prot:

ATX10_HUMAN :
  • Belongs to the ataxin-10 family.
Family:
  • Belongs to the ataxin-10 family.
genes like me logo Genes that share domains with ATXN10: view

Function for ATXN10 Gene

Molecular function for ATXN10 Gene

UniProtKB/Swiss-Prot Function:
Necessary for the survival of cerebellar neurons. Induces neuritogenesis by activating the Ras-MAP kinase pathway. May play a role in the maintenance of a critical intracellular glycosylation level and homeostasis.

Phenotypes From GWAS Catalog for ATXN10 Gene

Gene Ontology (GO) - Molecular Function for ATXN10 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16498633
GO:0019899 enzyme binding IEA --
GO:0042802 identical protein binding IEA --
genes like me logo Genes that share ontologies with ATXN10: view
genes like me logo Genes that share phenotypes with ATXN10: view

Human Phenotype Ontology for ATXN10 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for ATXN10 Gene

MGI Knock Outs for ATXN10:

miRNA for ATXN10 Gene

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for ATXN10 Gene

Localization for ATXN10 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ATXN10 Gene

Cytoplasm, perinuclear region.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ATXN10 gene
Compartment Confidence
plasma membrane 5
extracellular 5
cytosol 5
mitochondrion 2
nucleus 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Plasma membrane (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ATXN10 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005615 extracellular space IDA,HDA 23580065
GO:0005737 cytoplasm IDA,IEA 15201271
GO:0005829 cytosol IDA --
GO:0005886 plasma membrane IDA --
GO:0016020 membrane HDA,IDA 19946888
genes like me logo Genes that share ontologies with ATXN10: view

Pathways & Interactions for ATXN10 Gene

genes like me logo Genes that share pathways with ATXN10: view

Pathways by source for ATXN10 Gene

2 Qiagen pathways for ATXN10 Gene

SIGNOR curated interactions for ATXN10 Gene

Is inactivated by:

Gene Ontology (GO) - Biological Process for ATXN10 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007399 nervous system development IMP 16385455
GO:0031175 neuron projection development IDA 16498633
GO:0060271 cilium assembly IEA --
GO:0070207 protein homotrimerization IEA --
genes like me logo Genes that share ontologies with ATXN10: view

Drugs & Compounds for ATXN10 Gene

No Compound Related Data Available

Transcripts for ATXN10 Gene

Unigene Clusters for ATXN10 Gene

Ataxin 10:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ATXN10 Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10 ^ 11a · 11b ^ 12a · 12b ^ 13a · 13b ^ 14 ^ 15a · 15b ^ 16 ^ 17 ^ 18a ·
SP1: - - - - - - - - - -
SP2: - - - - - - - - -
SP3: - -
SP4: -
SP5: - - - - - -
SP6: - - -
SP7:
SP8: -
SP9: -
SP10: - - - -

ExUns: 18b · 18c · 18d
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9:
SP10:

Relevant External Links for ATXN10 Gene

GeneLoc Exon Structure for
ATXN10
ECgene alternative splicing isoforms for
ATXN10

Expression for ATXN10 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ATXN10 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for ATXN10 Gene

This gene is overexpressed in Bone (46.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for ATXN10 Gene



Protein tissue co-expression partners for ATXN10 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of ATXN10 Gene:

ATXN10

SOURCE GeneReport for Unigene cluster for ATXN10 Gene:

Hs.475125

mRNA Expression by UniProt/SwissProt for ATXN10 Gene:

Q9UBB4-ATX10_HUMAN
Tissue specificity: Expressed in the central nervous system.

Evidence on tissue expression from TISSUES for ATXN10 Gene

  • Nervous system(5)
  • Adrenal gland(4.4)
  • Liver(4.4)
  • Eye(2.1)
  • Lung(2.1)
  • Thyroid gland(2.1)
  • Heart(2)
  • Muscle(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ATXN10 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • digestive
  • nervous
  • skeletal muscle
  • skeleton
  • urinary
Organs:
Head and neck:
  • brain
  • cerebellum
  • eye
  • head
  • mouth
  • pharynx
Thorax:
  • esophagus
Abdomen:
  • stomach
Pelvis:
  • prostate
  • urethra
  • urinary bladder
Limb:
  • lower limb
  • upper limb
General:
  • peripheral nerve
  • peripheral nervous system
  • spinal cord
genes like me logo Genes that share expression patterns with ATXN10: view

No data available for mRNA differential expression in normal tissues for ATXN10 Gene

Orthologs for ATXN10 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for ATXN10 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ATXN10 33 34
  • 99.51 (n)
dog
(Canis familiaris)
Mammalia ATXN10 33 34
  • 88.44 (n)
cow
(Bos Taurus)
Mammalia ATXN10 33 34
  • 86.15 (n)
rat
(Rattus norvegicus)
Mammalia Atxn10 33
  • 83.3 (n)
mouse
(Mus musculus)
Mammalia Atxn10 33 16 34
  • 83.23 (n)
oppossum
(Monodelphis domestica)
Mammalia ATXN10 34
  • 57 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia ATXN10 34
  • 48 (a)
OneToOne
chicken
(Gallus gallus)
Aves ATXN10 33 34
  • 65.59 (n)
lizard
(Anolis carolinensis)
Reptilia ATXN10 34
  • 51 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia atxn10 33
  • 57.86 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.6373 33
zebrafish
(Danio rerio)
Actinopterygii atxn10 33 34
  • 51.86 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CTR86 34 36
  • 17 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea CSA.6792 34
  • 28 (a)
OneToOne
Species where no ortholog for ATXN10 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ATXN10 Gene

ENSEMBL:
Gene Tree for ATXN10 (if available)
TreeFam:
Gene Tree for ATXN10 (if available)

Paralogs for ATXN10 Gene

(1) SIMAP similar genes for ATXN10 Gene using alignment to 4 proteins:

genes like me logo Genes that share paralogs with ATXN10: view

No data available for Paralogs for ATXN10 Gene

Variants for ATXN10 Gene

Sequence variations from dbSNP and Humsavar for ATXN10 Gene

SNP ID Clin Chr 22 pos Variation AA Info Type
rs60726084 conflicting-interpretations-of-pathogenicity, Spinocerebellar ataxia 10 45,795,355(+) ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT/ATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT intron_variant
rs61733598 likely-benign, not specified 45,693,008(+) G/A coding_sequence_variant, synonymous_variant
rs772813026 uncertain-significance, not provided 45,738,784(+) T/TT coding_sequence_variant, frameshift
rs376717467 uncertain-significance, not specified 45,738,744(+) C/T coding_sequence_variant, missense_variant
rs1000000725 -- 45,845,142(+) AGAA/AGAAGAA 3_prime_UTR_variant

Structural Variations from Database of Genomic Variants (DGV) for ATXN10 Gene

Variant ID Type Subtype PubMed ID
dgv2469n106 OTHER inversion 24896259
dgv4588n100 CNV gain 25217958
dgv73n68 CNV gain 17160897
esv2724410 CNV deletion 23290073
esv3568449 CNV loss 25503493
esv3575493 CNV gain 25503493
nsv1058557 CNV gain 25217958
nsv1059671 CNV gain 25217958
nsv1060261 CNV loss 25217958
nsv1064179 CNV loss 25217958
nsv1066204 CNV gain 25217958
nsv1152661 OTHER inversion 26484159
nsv1160778 CNV duplication 26073780
nsv1160779 CNV duplication 26073780
nsv472263 CNV novel sequence insertion 20440878
nsv477251 CNV novel sequence insertion 20440878
nsv527209 CNV loss 19592680
nsv589130 CNV loss 21841781
nsv589131 CNV gain 21841781

Variation tolerance for ATXN10 Gene

Residual Variation Intolerance Score: 28.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.21; 24.37% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ATXN10 Gene

Human Gene Mutation Database (HGMD)
ATXN10
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ATXN10

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ATXN10 Gene

Disorders for ATXN10 Gene

MalaCards: The human disease database

(7) MalaCards diseases for ATXN10 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
spinocerebellar ataxia 10
  • sca10
autosomal dominant cerebellar ataxia
  • spinocerebellar ataxia
spinocerebellar ataxia 8
  • sca8
spinocerebellar ataxia 36
  • sca36
cerebellar disease
  • cerebellar dysfunction
- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

ATX10_HUMAN
  • Note=Defects in ATXN1 may be a cause of nephronophthisis a chronic tubulo-interstitial nephropathy that leads to anemia, polyuria, polydipsia, isosthenuria and death in uremia. {ECO:0000269 PubMed:21565611}.
  • Spinocerebellar ataxia 10 (SCA10) [MIM:603516]: Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA10 is an autosomal dominant cerebellar ataxia (ADCA). {ECO:0000269 PubMed:11017075}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for ATXN10

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ATXN10: view

No data available for Genatlas for ATXN10 Gene

Publications for ATXN10 Gene

  1. Ataxin 10 induces neuritogenesis via interaction with G-protein beta2 subunit. (PMID: 16498633) Waragai M … Ashizawa T (Journal of neuroscience research 2006) 3 4 22 58
  2. Ataxin-10, the spinocerebellar ataxia type 10 neurodegenerative disorder protein, is essential for survival of cerebellar neurons. (PMID: 15201271) März P … Ozbek S (The Journal of biological chemistry 2004) 3 4 22 58
  3. Large expansion of the ATTCT pentanucleotide repeat in spinocerebellar ataxia type 10. (PMID: 11017075) Matsuura T … Ashizawa T (Nature genetics 2000) 3 4 22 58
  4. Mapping the NPHP-JBTS-MKS protein network reveals ciliopathy disease genes and pathways. (PMID: 21565611) Sang L … Jackson PK (Cell 2011) 3 4 58
  5. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58

Products for ATXN10 Gene

Sources for ATXN10 Gene

Content
Loading form....