Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ATP6V0C Gene

Aliases for ATP6V0C Gene

  • ATPase H+ Transporting V0 Subunit C 2 3
  • ATPase, H+ Transporting, Lysosomal 16kDa, V0 Subunit C 2 3 5
  • Vacuolar Proton Pump 16 KDa Proteolipid Subunit 3 4
  • V-ATPase 16 KDa Proteolipid Subunit 3 4
  • ATP6C 3 4
  • ATP6L 3 4
  • ATPL 3 4
  • ATPase, H+ Transporting, Lysosomal (Vacuolar Proton Pump) 16kD 2
  • H(+)-Transporting Two-Sector ATPase, 16 KDa Subunit 3
  • Vacuolar ATP Synthase 16 KDa Proteolipid Subunit 3
  • Vacuolar H+ ATPase Proton Channel Subunit 3
  • VATL 3
  • VPPC 3
  • Vma3 3

External Ids for ATP6V0C Gene

Previous HGNC Symbols for ATP6V0C Gene

  • ATPL
  • ATP6C
  • ATP6L

Previous GeneCards Identifiers for ATP6V0C Gene

  • GC16P002565
  • GC16P002503
  • GC16P002563

Summaries for ATP6V0C Gene

Entrez Gene Summary for ATP6V0C Gene

  • This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. This gene encodes the V0 subunit c. Alternative splicing results in transcript variants. Pseudogenes have been identified on chromosomes 6 and 17. [provided by RefSeq, Nov 2010]

GeneCards Summary for ATP6V0C Gene

ATP6V0C (ATPase H+ Transporting V0 Subunit C) is a Protein Coding gene. Diseases associated with ATP6V0C include Progressive Myoclonic Epilepsy With Dystonia and Dravet Syndrome. Among its related pathways are Synaptic vesicle cycle and Immune System. GO annotations related to this gene include ubiquitin protein ligase binding and proton-transporting ATPase activity, rotational mechanism.

UniProtKB/Swiss-Prot for ATP6V0C Gene

  • Proton-conducting pore forming subunit of the membrane integral V0 complex of vacuolar ATPase. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells.

Tocris Summary for ATP6V0C Gene

  • H+-ATPase (also known as vacuolar ATPase, V-ATPase) is a enzyme transporter that functions to acidify intracellular compartments in eukaryotic cells. It is ubiquitously expressed and is present in endomembrane organelles such as vacuoles, lysosomes and endosomes.

Gene Wiki entry for ATP6V0C Gene

No data available for PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ATP6V0C Gene

Genomics for ATP6V0C Gene

Regulatory Elements for ATP6V0C Gene

Enhancers for ATP6V0C Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around ATP6V0C on UCSC Golden Path with GeneCards custom track

Promoters for ATP6V0C Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around ATP6V0C on UCSC Golden Path with GeneCards custom track

Genomic Location for ATP6V0C Gene

2,513,726 bp from pter
2,520,223 bp from pter
6,498 bases
Plus strand

Genomic View for ATP6V0C Gene

Genes around ATP6V0C on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ATP6V0C Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ATP6V0C Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ATP6V0C Gene

Proteins for ATP6V0C Gene

  • Protein details for ATP6V0C Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    V-type proton ATPase 16 kDa proteolipid subunit
    Protein Accession:
    Secondary Accessions:
    • Q6FH26

    Protein attributes for ATP6V0C Gene

    155 amino acids
    Molecular mass:
    15736 Da
    Quaternary structure:
    • V-ATPase is a heteromultimeric enzyme composed of a peripheral catalytic V1 complex (main components: subunits A, B, C, D, E, and F) attached to an integral membrane V0 proton pore complex (main component: the proteolipid protein; which is present as a hexamer that forms the proton-conducting pore). Interacts with LASS2. Interacts with HTLV-1 accessory protein p12I. Interacts with RNF182; this interaction leads to ubiquitination and degradation via the proteasome pathway.

neXtProt entry for ATP6V0C Gene

Proteomics data for ATP6V0C Gene at MOPED

Post-translational modifications for ATP6V0C Gene

  • Ubiquitinated by RNF182, leading to its degradation via the ubiquitin-proteasome pathway.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for ATP6V0C Gene

Antibody Products

No data available for DME Specific Peptides for ATP6V0C Gene

Domains & Families for ATP6V0C Gene

Gene Families for ATP6V0C Gene


Suggested Antigen Peptide Sequences for ATP6V0C Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the V-ATPase proteolipid subunit family.
  • Belongs to the V-ATPase proteolipid subunit family.
genes like me logo Genes that share domains with ATP6V0C: view

Function for ATP6V0C Gene

Molecular function for ATP6V0C Gene

UniProtKB/Swiss-Prot Function:
Proton-conducting pore forming subunit of the membrane integral V0 complex of vacuolar ATPase. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells.

Gene Ontology (GO) - Molecular Function for ATP6V0C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0031625 ubiquitin protein ligase binding IPI 18298843
genes like me logo Genes that share ontologies with ATP6V0C: view
genes like me logo Genes that share phenotypes with ATP6V0C: view

Animal Models for ATP6V0C Gene

MGI Knock Outs for ATP6V0C:

Animal Model Products

CRISPR Products

miRNA for ATP6V0C Gene

miRTarBase miRNAs that target ATP6V0C

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for ATP6V0C Gene

Localization for ATP6V0C Gene

Subcellular locations from UniProtKB/Swiss-Prot for ATP6V0C Gene

Vacuole membrane; Multi-pass membrane protein.

Subcellular locations from

Jensen Localization Image for ATP6V0C Gene COMPARTMENTS Subcellular localization image for ATP6V0C gene
Compartment Confidence
extracellular 5
lysosome 5
vacuole 5
endosome 4
plasma membrane 3
cytosol 1

Gene Ontology (GO) - Cellular Components for ATP6V0C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005765 lysosomal membrane IDA 17897319
GO:0005925 focal adhesion IDA 21423176
GO:0070062 extracellular exosome IDA 19056867
genes like me logo Genes that share ontologies with ATP6V0C: view

Pathways & Interactions for ATP6V0C Gene

genes like me logo Genes that share pathways with ATP6V0C: view

Gene Ontology (GO) - Biological Process for ATP6V0C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0015991 ATP hydrolysis coupled proton transport IEA --
GO:0016032 viral process IEA --
GO:0016241 regulation of macroautophagy NAS 22982048
GO:0034220 ion transmembrane transport TAS --
GO:0055085 transmembrane transport TAS --
genes like me logo Genes that share ontologies with ATP6V0C: view

No data available for SIGNOR curated interactions for ATP6V0C Gene

Drugs & Compounds for ATP6V0C Gene

(3) Drugs for ATP6V0C Gene - From: HMDB and Tocris

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Adenosine triphosphate Approved Nutra 0
Disulfiram Approved Pharma Reversibly stimulates SERCA Ca2+-ATPase; displays a range of other activities 34
Bafilomycin A1 Experimental Pharma H+-ATPase (vacuolar) inhibitor 0

(5) Additional Compounds for ATP6V0C Gene - From: HMDB and Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • Adenosindiphosphorsaeure
  • Adenosine 5'-pyrophosphate
  • Adenosine diphosphate
  • Adenosine pyrophosphate
  • Adenosine-5'-diphosphate
Full agonist, Agonist 58-64-0
  • NFB Orthophosphate
  • O-Phosphoric acid
  • Ortho-phosphate
  • Orthophosphate (PO43-)
  • Orthophosphate(3-)
  • Dihydrogen oxide
  • Steam
Concanamycin A

(4) Tocris Compounds for ATP6V0C Gene

Compound Action Cas Number
Bafilomycin A1 H+-ATPase (vacuolar) inhibitor 88899-55-2
Concanamycin A H+-ATPase (vacuolar) inhibitor 80890-47-7
Disulfiram Reversibly stimulates SERCA Ca2+-ATPase; displays a range of other activities 97-77-8
Enterostatin Binds to beta-subunit of F1-ATPase; anorexigenic peptide 117830-79-2
genes like me logo Genes that share compounds with ATP6V0C: view

Transcripts for ATP6V0C Gene

Unigene Clusters for ATP6V0C Gene

ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for ATP6V0C Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3a · 3b ^ 4a · 4b · 4c · 4d
SP1: - -
SP2: - - -
SP3: -

Relevant External Links for ATP6V0C Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for ATP6V0C Gene

mRNA expression in normal human tissues for ATP6V0C Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for ATP6V0C Gene

This gene is overexpressed in Retina (11.1) and Brain (9.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for ATP6V0C Gene

SOURCE GeneReport for Unigene cluster for ATP6V0C Gene Hs.389107

genes like me logo Genes that share expression patterns with ATP6V0C: view

Primer Products

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for ATP6V0C Gene

Orthologs for ATP6V0C Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for ATP6V0C Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia ATP6V0C 35
  • 90.32 (n)
  • 96.77 (a)
ATP6V0C 36
  • 97 (a)
(Canis familiaris)
Mammalia ATP6V0C 35
  • 90.11 (n)
  • 96.77 (a)
ATP6V0C 36
  • 97 (a)
(Mus musculus)
Mammalia Atp6v0c 35
  • 86.88 (n)
  • 90.97 (a)
Atp6v0c 16
Atp6v0c 36
  • 91 (a)
(Pan troglodytes)
Mammalia ATP6V0C 35
  • 99.35 (n)
  • 99.35 (a)
ATP6V0C 36
  • 99 (a)
(Rattus norvegicus)
Mammalia Atp6v0c 35
  • 86.67 (n)
  • 90.97 (a)
(Monodelphis domestica)
Mammalia -- 36
  • 84 (a)
-- 36
  • 77 (a)
-- 36
  • 69 (a)
(Gallus gallus)
Aves ATP6V0C 35
  • 78.65 (n)
  • 93.46 (a)
ATP6V0C 36
  • 94 (a)
(Anolis carolinensis)
Reptilia ATP6V0C 36
  • 92 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia atp6v0c 35
  • 77.06 (n)
  • 91.56 (a)
MGC75730 35
African clawed frog
(Xenopus laevis)
Amphibia MGC64475 35
(Danio rerio)
Actinopterygii atp6v0c 35
atp6v0cb 35
  • 80.7 (n)
  • 92.76 (a)
atp6v0ca 36
  • 90 (a)
atp6v0cb 36
  • 93 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.13983 35
fruit fly
(Drosophila melanogaster)
Insecta CG9013 37
  • 65 (a)
Vha16 37
  • 81 (a)
Vha16-1 35
  • 74.78 (n)
  • 82.24 (a)
Vha16-1 36
  • 80 (a)
Vha16-2 36
  • 66 (a)
Vha16-3 36
  • 75 (a)
Vha16-4 36
  • 65 (a)
Vha16-5 36
  • 50 (a)
(Caenorhabditis elegans)
Secernentea vha-2 37
  • 67 (a)
vha-2 35
  • 64.27 (n)
  • 67.97 (a)
vha-1 36
  • 55 (a)
vha-2 36
  • 63 (a)
vha-3 36
  • 63 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AEL074W 35
  • 61.84 (n)
  • 71.05 (a)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0E22441g 35
  • 59.21 (n)
  • 71.71 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes VMA3 35
  • 59.23 (n)
  • 71.62 (a)
VMA3 36
  • 68 (a)
VMA11 38
(Glycine max)
eudicotyledons Gma.12504 35
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.1223 35
(Hordeum vulgare)
Liliopsida Hv.861 35
(Oryza sativa)
Liliopsida Os.5911 35
Os01g0962300 35
  • 68.6 (n)
  • 62.58 (a)
(Triticum aestivum)
Liliopsida Ta.28372 35
(Zea mays)
Liliopsida Zm.6210 35
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.10414 35
bread mold
(Neurospora crassa)
Ascomycetes NCU01332 35
  • 66.67 (n)
  • 73.68 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes vma3 35
  • 62.39 (n)
  • 76.35 (a)
Species with no ortholog for ATP6V0C:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)

Evolution for ATP6V0C Gene

Gene Tree for ATP6V0C (if available)
Gene Tree for ATP6V0C (if available)

Paralogs for ATP6V0C Gene

(1) SIMAP similar genes for ATP6V0C Gene using alignment to 3 proteins: Pseudogenes for ATP6V0C Gene

genes like me logo Genes that share paralogs with ATP6V0C: view

No data available for Paralogs for ATP6V0C Gene

Variants for ATP6V0C Gene

Sequence variations from dbSNP and Humsavar for ATP6V0C Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs78327465 -- 2,512,389(+) GAGGG(C/T)GTCTG upstream-variant-2KB
rs5815126 -- 2,516,291(+) TTTTT(-/T)AGAGA intron-variant
rs28459821 -- 2,516,614(+) CACAA(A/G)CCTCT intron-variant
rs28707189 -- 2,516,751(+) GCGAG(C/T)GCCTT intron-variant
rs71148138 -- 2,520,638(-) GCCCG(-/GTCCCCGGCCCCGCACCCTGCACCCCGCCCT)GTCCC downstream-variant-500B

Structural Variations from Database of Genomic Variants (DGV) for ATP6V0C Gene

Variant ID Type Subtype PubMed ID
esv2422427 CNV Duplication 17116639
dgv2545n71 CNV Loss 21882294
nsv905139 CNV Loss 21882294
nsv833121 CNV Loss 17160897
dgv2569n71 CNV Loss 21882294
dgv2570n71 CNV Loss 21882294
nsv905149 CNV Loss 21882294
nsv905152 CNV Loss 21882294
nsv905153 CNV Loss 21882294
dgv793e1 CNV Complex 17122850
nsv833122 CNV Loss 17160897
dgv2571n71 CNV Loss 21882294

Variation tolerance for ATP6V0C Gene

Residual Variation Intolerance Score: 35.9% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for ATP6V0C Gene

Human Gene Mutation Database (HGMD)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ATP6V0C Gene

Disorders for ATP6V0C Gene

MalaCards: The human disease database

(2) MalaCards diseases for ATP6V0C Gene - From: GeneCards

Disorder Aliases PubMed IDs
progressive myoclonic epilepsy with dystonia
  • pmed
dravet syndrome
  • dravet syndrome, modifier of
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for ATP6V0C

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with ATP6V0C: view

No data available for UniProtKB/Swiss-Prot and Genatlas for ATP6V0C Gene

Publications for ATP6V0C Gene

  1. CpG island in the region of an autosomal dominant polycystic kidney disease locus defines the 5' end of a gene encoding a putative proton channel. (PMID: 1709739) Gillespie G.A.J. … Reeders S.T. (Proc. Natl. Acad. Sci. U.S.A. 1991) 2 3 4 67
  2. Small interfering RNA targeting the subunit ATP6L of proton pump V-ATPase overcomes chemoresistance of breast cancer cells. (PMID: 19299075) You H. … Qin W. (Cancer Lett. 2009) 3 23
  3. Chromosomal localization of three vacuolar-H+ -ATPase 16 kDa subunit (ATP6V0C) genes in the murine genome. (PMID: 12438748) Simckes A.M. … White R.A. (Cytogenet. Genome Res. 2002) 3 23
  4. Cloning and tissue distribution of subunits C, D, and E of the human vacuolar H(+)-ATPase. (PMID: 8250920) van Hille B. … Bilbe G. (Biochem. Biophys. Res. Commun. 1993) 2 3
  5. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3

Products for ATP6V0C Gene

Sources for ATP6V0C Gene
