Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



ATP11A Gene

protein-coding   GIFtS: 61
GCID: GC13P113344

ATPase, Class VI, Type 11A

(Previous names: ATPase, Class VI, type 11A)
  See ATP11A-related disease
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
ATPase, Class VI, Type 11A1 2     Probable Phospholipid-Transporting ATPase IH2
ATPIH2 3 5     KIAA10213
ATPIS2 3 5     ATPase Class VI Type 11A3
Phospholipid-Translocating ATPase1 2     ATPase IS3
Potential Phospholipid-Transporting ATPase IH1 2     EC 3.6.38
EC 3.6.3.13 8     

External Ids:    HGNC: 135521   Entrez Gene: 232502   Ensembl: ENSG000000686507   OMIM: 6058685   UniProtKB: P981963   

Export aliases for ATP11A gene to outside databases

Previous GC identifers: GC13P112090 GC13P107981 GC13P112526 GC13P111385 GC13P112487 GC13P112393 GC13P093786


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for ATP11A Gene:
The protein encoded by this gene is an integral membrane ATPase. The encoded protein is probably phosphorylated in
its intermediate state and likely drives the transport of ions such as calcium across membranes. Two transcript
variants encoding different isoforms have been found for this gene. (provided by RefSeq, Jul 2008)

GeneCards Summary for ATP11A Gene:
ATP11A (ATPase, class VI, type 11A) is a protein-coding gene. Diseases associated with ATP11A include idiopathic pulmonary fibrosis. GO annotations related to this gene include phospholipid-translocating ATPase activity and magnesium ion binding. An important paralog of this gene is ATP8B1.




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000013.10  NT_027140.7  NC_018924.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the ATP11A gene promoter:
         CUTL1   Ik-3   HNF-3beta   Evi-1   Arnt   MEF-2A   FOXO4   FOXO1a   aMEF-2   FOXO1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidATP11A promoter sequence
   Search Chromatin IP Primers for ATP11A

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ATP11A


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 13q34   Ensembl cytogenetic band:  13q34   HGNC cytogenetic band: 13q34

ATP11A Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ATP11A gene location

GeneLoc information about chromosome 13         GeneLoc Exon Structure

GeneLoc location for GC13P113344:  view genomic region     (about GC identifiers)

Start:
113,344,643 bp from pter      End:
113,541,482 bp from pter
Size:
196,840 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., and/or eBioscience,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., and/or eBioscience, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: AT11A_HUMAN, P98196 (See protein sequence)
Recommended Name: Probable phospholipid-transporting ATPase IH  
Size: 1134 amino acids; 129756 Da
Subunit: Interacts with TMEM30A, but not with TMEM30B
Secondary accessions: Q5VXT2

Explore the universe of human proteins at neXtProt for ATP11A: NX_P98196

Explore proteomics data for ATP11A at MOPED

Post-translational modifications: 

  • Ubiquitination2 at Lys702
  • Modification sites at PhosphoSitePlus
  • Selected DME Specific Peptides for ATP11A (P98196) (see all 15)
     GNWTFGT  LFEQFRR  LAIGDGA  TLAIGDG 


    See ATP11A Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (2 alternative transcripts): 
    NP_056020.2  NP_115565.3  

    ENSEMBL proteins: 
     ENSP00000420387   ENSP00000396374   ENSP00000420696   ENSP00000410824   ENSP00000402575  
     ENSP00000364781   ENSP00000364796   ENSP00000283558  
    Reactome Protein details: P98196

    ATP11A Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec
    OriGene Custom Protein Services for ATP11A
    GenScript Custom Purified and Recombinant Proteins Services for ATP11A
    Novus Biologicals ATP11A Protein
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for ATP11A

     
    Search eBioscience for Proteins for ATP11A 

    ATP11A Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for ATP11A
    OriGene Custom Antibody Services for ATP11A
    Novus Biologicals ATP11A Antibodies
    Abcam antibodies for ATP11A
    Cloud-Clone Corp. Antibodies for ATP11A
    ThermoFisher Antibodies for ATP11A
    LSBio Antibodies in human, mouse, rat for ATP11A

    ATP11A Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for ATP11A
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ATP11A
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for ATP11A
    Cloud-Clone Corp. CLIAs for ATP11A
    Search eBioscience for ELISAs for ATP11A 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    PATP: ATPases / P-type

    IUPHAR Guide to PHARMACOLOGY protein family classification: ATP11A
    Phospholipid-transporting ATPase

    Selected InterPro protein domains (see all 6):
     IPR008250 ATPase_P-typ_transduc_dom_A
     IPR023214 HAD-like_dom
     IPR006539 ATPase_P-typ_Plipid-transp
     IPR001757 Cation_transp_P_typ_ATPase
     IPR018303 ATPase_P-typ_P_site

    Graphical View of Domain Structure for InterPro Entry P98196

    ProtoNet protein and cluster: P98196

    1 Blocks protein domain: IPB001757 ATPase

    UniProtKB/Swiss-Prot: AT11A_HUMAN, P98196
    Similarity: Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family. Type IV subfamily


    Find genes that share domains with ATP11A           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: AT11A_HUMAN, P98196
    Catalytic activity: ATP + H(2)O + phospholipid(Side 1) = ADP + phosphate + phospholipid(Side 2)

         Enzyme Numbers (IUBMB): EC 3.6.3.11 2 EC 3.6.32

         Gene Ontology (GO): Selected molecular function terms (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000166nucleotide binding ----
    GO:0000287magnesium ion binding IEA--
    GO:0004012phospholipid-translocating ATPase activity IEA--
    GO:0005515protein binding IPI--
    GO:0005524ATP binding IEA--
         
    Find genes that share ontologies with ATP11A           About GenesLikeMe


    Phenotypes:
         1 MGI mutant phenotype (inferred from 1 allele(MGI details for Atp11a):
     mortality/aging 

    Find genes that share phenotypes with ATP11A           About GenesLikeMe

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ATP11A
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ATP11A

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for ATP11A
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for ATP11A

    miRNA
    Products:
        
    miRTarBase miRNAs that target ATP11A:
    hsa-mir-744-5p (MIRT037411), hsa-mir-197-3p (MIRT048064), hsa-mir-769-5p (MIRT039140), hsa-mir-484 (MIRT042225), hsa-mir-92a-3p (MIRT049412)

    Block miRNA regulation of human, mouse, rat ATP11A using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate ATP11A (see all 90):
    hsa-miR-549 hsa-miR-140-5p hsa-miR-323-3p hsa-miR-607 hsa-miR-3607-3p hsa-miR-106a hsa-miR-502-3p hsa-miR-10b*
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for ATP11A
    Predesigned siRNA for gene silencing in human, mouse, rat ATP11A

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ATP11A

    Clone
    Products:
         
    OriGene clones in human, mouse for ATP11A (see all 12)
    OriGene ORF clones in mouse, rat for ATP11A
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): ATP11A (NM_015205)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ATP11A
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ATP11A

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ATP11A
    Browse ESI BIO Cell Lines and PureStem Progenitors for ATP11A 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ATP11A


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    AT11A_HUMAN, P98196: Cell membrane; Multi-pass membrane protein. Early endosome. Recycling endosome. Endoplasmic
    reticulum. Note=Exit from the endoplasmic reticulum requires the presence of TMEM30A, but not TMEM30B. In the
    presence of TMEM30A, predominantly located in the plasma membrane
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    endoplasmic reticulum5
    endosome5
    plasma membrane5
    chloroplast2
    cytoskeleton2
    cytosol2
    extracellular2
    mitochondrion2
    vacuole2
    golgi apparatus1
    lysosome1
    nucleus1

    Gene Ontology (GO): Selected cellular component terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005765lysosomal membrane IDA17897319
    GO:0005769early endosome IEA--
    GO:0005783endoplasmic reticulum IDA--
    GO:0005886plasma membrane IEA--
    GO:0016021integral component of membrane IEA--

    Find genes that share ontologies with ATP11A           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for ATP11A About    
    See pathways by source

    SuperPathContained pathways About
    1Ion channel transport
    Ion channel transport0.58
    2Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds
    Transmembrane transport of small molecules0.47
    3Ion transport by P-type ATPases
    Ion transport by P-type ATPases


    Find genes that share SuperPaths with ATP11A           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    1 Reactome Pathway for ATP11A
        Ion transport by P-type ATPases


        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for ATP11A
    Interactions:

        Search GeneGlobe Interaction Network for ATP11A

    STRING Interaction Network Preview (showing 5 interactants - click image to see 17)

    Selected Interacting proteins for ATP11A (ENSP000002835584) via UniProtKB, MINT, STRING, and/or I2D (see all 17)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    UBCENSP000003448184STRING: ENSP00000344818
    ATP6V0D1ENSP000002909494STRING: ENSP00000290949
    ATP6V0D2ENSP000002853934STRING: ENSP00000285393
    ATP1B1ENSP000003567894STRING: ENSP00000356789
    ATP6V1AENSP000002733984STRING: ENSP00000273398
    About this table

    Gene Ontology (GO): 3 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006812cation transport ----
    GO:0015914phospholipid transport ----
    GO:0045332phospholipid translocation NAS--

    Find genes that share ontologies with ATP11A           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for ATP11A (AT11A)

    Selected HMDB Compounds for ATP11A (see all 2605)    About this table
    CompoundSynonyms CAS #PubMed Ids
    PC(O-16:0/18:2(9Z,12Z))1-hexadecyl-2-(9Z,12Z-octadecadienoyl)-sn-glycero-3-phosphocholine (see all 5)88542-95-412486725
    PE(O-16:1(1Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z))1-alkenyl-2-acyl-glycerophosphoethanolamine (see all 15)--12486725
    PE(O-18:1(1Z)/20:4(5Z,8Z,11Z,14Z))1-alkenyl-2-acyl-glycerophosphoethanolamine (see all 19)103597-60-012486725
    PE(P-16:0e/0:0)2-azaniumylethyl [(2R)-3-[(E)-hexadec-1-enoxy]-2-hydroxy-propyl] phosphate;1-(1Z-hexadecenyl)-sn-glycero-3-phosphoethanolamine ;LysoPE(dm16:0e) --12486725
    PE(P-16:0e/18:1(9Z))2-(9Z-octadecanoyl)-1-hexadecyl-sn-glycero-3-phosphoethanolamine --12486725
    ADPadenosindiphosphorsaeure (see all 8)58-64-0--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--
    PA(16:0/16:0)Dipalmitoylphosphatidic acid (see all 25)7091-44-3--
    PA(16:0/18:1(11Z))PA(16:0/18:1n7) (see all 10)----
    PA(16:0/18:1(9Z))PA(16:0/18:1n9) (see all 10)----



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for ATP11A gene (2 alternative transcripts): 
    NM_015205.2  NM_032189.3  

    Unigene Cluster for ATP11A:

    ATPase, class VI, type 11A
    Hs.29189  [show with all ESTs]
    Unigene Representative Sequence: NM_015205
    16 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000487903 ENST00000419448 ENST00000466946 ENST00000459908(uc001vsm.1)
    ENST00000418678 ENST00000489577 ENST00000471555 ENST00000459011 ENST00000419631
    ENST00000495930 ENST00000493489 ENST00000415301 ENST00000479193 ENST00000375630(uc001vsj.4)
    ENST00000375645(uc001vsi.4 uc010ago.3) ENST00000283558
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat ATP11A using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate ATP11A (see all 90):
    hsa-miR-549 hsa-miR-140-5p hsa-miR-323-3p hsa-miR-607 hsa-miR-3607-3p hsa-miR-106a hsa-miR-502-3p hsa-miR-10b*
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for ATP11A
    Predesigned siRNA for gene silencing in human, mouse, rat ATP11A
    Clone
    Products:
         
    OriGene clones in human, mouse for ATP11A (see all 12)
    OriGene ORF clones in mouse, rat for ATP11A
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): ATP11A (NM_015205)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ATP11A
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ATP11A
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for ATP11A
    Pre-validated RT2 qPCR Primer Assay in human, mouse / rat ATP11A
      QuantiTect SYBR Green Assays in human, mouse, rat ATP11A
      QuantiFast Probe-based Assays in human, mouse, rat ATP11A

    Additional mRNA sequence: 

    AB028944.2 AK024264.1 AK025511.1 AK091253.1 AL161996.1 BC008824.1 BC024154.2 BC035215.1 
    BC044649.1 

    12 DOTS entries:

    DT.101956757  DT.441976  DT.120784838  DT.100789013  DT.95193832  DT.430520  DT.95156275  DT.100789011 
    DT.95343104  DT.95358571  DT.99938048  DT.97825463 

    Selected AceView cDNA sequences (see all 186):

    AI264584 AA347469 BE386361 BM783838 BG939369 BU070690 CB267821 CF242832 
    AI263969 AA235037 BU620537 CA435069 CA425028 BX356374 BM920369 AA020973 
    AA348163 AW298179 AW068936 BF515075 AW068902 BM807197 AW629774 AA235205 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for ATP11A (see all 6)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23a · 23b ^
    SP1:                                                                                                                                                        -   
    SP2:                                                                                                                                                            
    SP3:                                                                                                                                                            
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            

    ExUns: 24 ^ 25a · 25b ^ 26a · 26b ^ 27a · 27b ^ 28a · 28b ^ 29 ^ 30a · 30b · 30c
    SP1:                    -                                                         
    SP2:                                                                              
    SP3:                                                                              
    SP4:                    -                       -     -     -                     
    SP5:                                                                              


    ECgene alternative splicing isoforms for ATP11A

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    ATP11A expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: AATGGTATCC
    ATP11A Expression
    About this image


    ATP11A expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 2) fully expand
     
     Gut Tube (Gastrointestinal Tract)    fully expand to see all 2 entries
             Foregut
     
     Kidney (Urinary System)
    ATP11A Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    ATP11A Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.29189
        Custom PCR Arrays for ATP11A
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for ATP11A
    Pre-validated RT2 qPCR Primer Assay in human, mouse / rat ATP11A
    QuantiTect SYBR Green Assays in human, mouse, rat ATP11A
    QuantiFast Probe-based Assays in human, mouse, rat ATP11A
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ATP11A

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for ATP11A gene from Selected species (see all 12)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Atp11a1 , 5 ATPase, class VI, type 11A1, 5 83.35(n)1
    91.09(a)1
      8 (5.73 cM)5
    507701  NM_015804.31  NP_056619.11 
     127570145 
    chicken
    (Gallus gallus)
    Aves ATP11A1 ATPase, class VI, type 11A 76.76(n)
    86.89(a)
      418749  XM_416948.4  XP_416948.4 
    lizard
    (Anolis carolinensis)
    Reptilia ATP11A6
    ATPase, class VI, type 11A
    81(a)
    1 ↔ 1
    3(105622834-105763922)
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia atp11a1 ATPase, class VI, type 11A 75.12(n)
    85.68(a)
      100485769  XM_002933015.2  XP_002933061.2 
    zebrafish
    (Danio rerio)
    Actinopterygii atp11a1 ATPase, class VI, type 11A 74.77(n)
    82.4(a)
      562925  XM_005171001.1  XP_005171058.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG43013 calcium-transporting ATPase 38(a)
    (best of 2)
      14C4   --


    ENSEMBL Gene Tree for ATP11A (if available)
    TreeFam Gene Tree for ATP11A (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for ATP11A gene
    ATP8B12  ATP11B2  ATP8A12  ATP11C2  ATP8B42  ATP8A22  ATP8B22  ATP8B32  
    13 SIMAP similar genes for ATP11A using alignment to 9 protein entries:     AT11A_HUMAN (see all proteins):
    DKFZp434P0831    ATP11C    DKFZp779H1459    ATP11B    ATP8B4    ATP8A1
    ATP10A    ATP8B2    ATP8A2    ATP8B1    ATP8B3    ATP9B
    ATP9A

    Find genes that share paralogs with ATP11A           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for ATP11A (see all 5981)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 13 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs711015361,2
    C,F--94455882(+) AGTGC-/AGGCCTGC/AGGCCTGCGCAGCTTCCCAGCGGGGT
    CCATCACCACCTGCGCAGTAATTCAGTGC
    /GGCCCAT
    GGCCC
    2 -- int12NA 4
    rs38329101,2
    C--94479147(+) CTCCC-/CTGAGTT 2 -- ut312Minor allele frequency- CT:0.25NA 4
    rs1906835011,2
    --113342725(+) AGTCAC/TGGTTT 2 -- us2k10--------
    rs1395969101,2
    --113342726(+) GTCACA/GGTTTA 2 -- us2k10--------
    rs1408369441,2
    C--113342878(+) AAGGG-/TGCTGCTA 2 -- us2k10--------
    rs593342501,2
    C,F--113342912(+) CAGACC/TGACAA 2 -- us2k13Minor allele frequency- T:0.19WA CSA 122
    rs1817818091,2
    C--113342943(+) TTGGGA/GGCGGG 2 -- us2k10--------
    rs1865108951,2
    --113342971(+) GAGCCC/TAGAGG 2 -- us2k10--------
    rs1493361101,2
    --113342999(+) GGCACC/TCAGGA 2 -- us2k10--------
    rs1909070701,2
    --113343033(+) CCAACA/CCTGGT 2 -- us2k10--------

    HapMap Linkage Disequilibrium report for ATP11A (113344643 - 113541482 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for ATP11A (see all 98):    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2748190CNV Deletion23290073
    esv2748176CNV Deletion23290073
    esv2748184CNV Deletion23290073
    esv2748171CNV Deletion23290073
    esv1707874CNV Deletion17803354
    esv1002642CNV Deletion20482838
    esv2748172CNV Deletion23290073
    esv2748203CNV Deletion23290073
    esv2748192CNV Deletion23290073
    esv2099073CNV Deletion18987734

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing ATP11A
    DNA2.0 Custom Variant and Variant Library Synthesis for ATP11A

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 605868    OMIM disorders: --

    1 disease for ATP11A:    
    About MalaCards
    idiopathic pulmonary fibrosis


    Find genes that share disorders with ATP11A           About GenesLikeMe

    Genetic Association Database (GAD): ATP11A
    Human Genome Epidemiology (HuGE) Navigator: ATP11A (2 documents)

    Export disorders for ATP11A gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for ATP11A gene, integrated from 10 sources (see all 19):
    (articles sorted by number of sources associating them with ATP11A)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. ATP9B, a P4-ATPase (a putative aminophospholipid translocase), localizes to the trans-Golgi network in a CDC50 protein-independent manner. (PubMed id 21914794)1, 2 Takatsu H.... Shin H.W. (J. Biol. Chem. 2011)
    2. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (Mol. Med. 2010)
    3. The DNA sequence and analysis of human chromosome 13. (PubMed id 15057823)1, 2 Dunham A.... Ross M.T. (Nature 2004)
    4. Prediction of the coding sequences of unidentified human genes. XIV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PubMed id 10470851)1, 2 Kikuno R.... Ohara O. (DNA Res. 1999)
    5. Differential expression of putative transbilayer amphipath transporters. (PubMed id 11015572)1, 3 Halleck M.S.... Schlegel R.A. (Physiol. Genomics 1999)
    6. Pathway Analysis of ChIP-Seq-Based NRF1 Target Genes Suggests a Logical Hypothesis of their Involvement in the Pathogenesis of Neurodegenerative Diseases. (PubMed id 24250222)1 Satoh J....Yamamoto Y. (Gene Regul Syst Bio 2013)
    7. Genome-wide association study identifies multiple susceptibility loci for pulmonary fibrosis. (PubMed id 23583980)1 Fingerlin T.E....Schwartz D.A. (Nat. Genet. 2013)
    8. Systems-wide analysis of ubiquitylation dynamics reveals a key role for PAF15 ubiquitylation in DNA-damage bypass. (PubMed id 23000965)1 Povlsen L.K....Choudhary C. (Nat. Cell Biol. 2012)
    9. A proteome-wide, quantitative survey of in vivo ubiquitylation sites reveals widespread regulatory roles. (PubMed id 21890473)1 Wagner S.A....Choudhary C. (amp 2011)
    10. Systematic and quantitative assessment of the ubiquitin-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (Mol. Cell 2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 23250 HGNC: 13552 AceView: ATP11A Ensembl:ENSG00000068650 euGenes: HUgn23250
    ECgene: ATP11A H-InvDB: ATP11A

    (According to HUGE)
    About This Section

    TryGeneCards Plus
    HUGE: KIAA1021

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for ATP11A Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for ATP11A gene:
    Search GeneIP for patents involving ATP11A

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, eBioscience, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for ATP11A   OriGene RNAi products in human, mouse, rat for ATP11A  
     Browse OriGene qPCR primer pairs and template standards   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for ATP11A  
     OriGene qSTAR qPCR primer pairs in human, mouse for ATP11A   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for ATP11A   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ATP11A   OriGene Custom Protein Services for ATP11A  

     
     
     Block miRNA regulation of human, mouse, rat ATP11A using miScript Target Protectors SeqTarget long-range PCR primers for resequencing ATP11A
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ATP11A Predesigned siRNA for gene silencing in human, mouse, rat ATP11A
     QuantiFast Probe-based Assays in human, mouse, rat ATP11A QuantiTect SYBR Green Assays in human, mouse, rat ATP11A
     Custom PCR Arrays for ATP11A Search Chromatin IP Primers for ATP11A
     Pre-validated RT2 qPCR Primer Assay in human, mouse / rat ATP11A  Search GeneGlobe Interaction Network for ATP11A
     Regulatory tfbs in ATP11A promoter
     GenScript Custom Purified and Recombinant Proteins Services for ATP11A GenScript cDNA clones with any tag delivered in your preferred vector for ATP11A
     GenScript Custom Assay Services for ATP11A GenScript Custom overexpressing Cell Line Services for ATP11A
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for ATP11A (AT11A)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     ATP11A antibodies
     ATP11A proteins
     Antibodies for ATP11A
     See all of Abcam's Antibodies, Kits and Proteins for ATP11A
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for ATP11A
     Antibodies for ATP11A
     ELISAs for ATP11A
     CLIAs for ATP11A



     Browse ESI BIO Cell Lines and PureStem Progenitors for ATP11A
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ATP11A
     Browse SwitchGear 3'UTR luciferase reporter plasmids for ATP11A
     SwitchGear Promoter luciferase reporter plasmids for ATP11A
     ThermoFisher Antibodies for ATP11A
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ATP11A
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ATP11A
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ATP11A
     LSBio Antibodies in human, mouse, rat for ATP11A
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
     Search Addgene for plasmids for ATP11A
      Search eBioscience for proteins for ATP11A
      Search eBioscience for elisas for ATP11A
      eBioscience FlowRNA Probe Sets
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ATP11A gene at Home site.
    Version: 3.12.224 13 Oct 2014
    hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4