Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

ATP11A Gene

protein-coding   GIFtS: 60
GCID: GC13P113344

ATPase, Class VI, Type 11A

(Previous names: ATPase, Class VI, type 11A)
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
ATPase, Class VI, Type 11A1 2     Probable Phospholipid-Transporting ATPase IH2
ATPIH2 3 5     KIAA10213
ATPIS2 3 5     ATPase Class VI Type 11A3
Phospholipid-Translocating ATPase1 2     ATPase IS3
Potential Phospholipid-Transporting ATPase IH1 2     EC 3.6.38
EC 3.6.3.13 8     

External Ids:    HGNC: 135521   Entrez Gene: 232502   Ensembl: ENSG000000686507   OMIM: 6058685   UniProtKB: P981963   

Export aliases for ATP11A gene to outside databases

Previous GC identifers: GC13P112090 GC13P107981 GC13P112526 GC13P111385 GC13P112487 GC13P112393 GC13P093786


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for ATP11A Gene:
The protein encoded by this gene is an integral membrane ATPase. The encoded protein is probably phosphorylated in
its intermediate state and likely drives the transport of ions such as calcium across membranes. Two transcript
variants encoding different isoforms have been found for this gene. (provided by RefSeq, Jul 2008)

GeneCards Summary for ATP11A Gene: 
ATP11A (ATPase, class VI, type 11A) is a protein-coding gene. Diseases associated with ATP11A include toxic myocarditis, and hypoparathyroidism, and among its related super-pathways are Ion channel transport and SLC-mediated transmembrane transport. GO annotations related to this gene include phospholipid-translocating ATPase activity and magnesium ion binding. An important paralog of this gene is ATP8A1.




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000013.10  NT_027140.6  NC_018924.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the ATP11A gene promoter:
         CUTL1   Ik-3   HNF-3beta   Evi-1   Arnt   MEF-2A   FOXO4   FOXO1a   aMEF-2   FOXO1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidATP11A promoter sequence
   Search SABiosciences Chromatin IP Primers for ATP11A

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ATP11A


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 13q34   Ensembl cytogenetic band:  13q34   HGNC cytogenetic band: 13q34

ATP11A Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ATP11A gene location

GeneLoc information about chromosome 13         GeneLoc Exon Structure

GeneLoc location for GC13P113344:  view genomic region     (about GC identifiers)

Start:
113,344,643 bp from pter      End:
113,541,482 bp from pter
Size:
196,840 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: AT11A_HUMAN, P98196 (See protein sequence)
Recommended Name: Probable phospholipid-transporting ATPase IH  
Size: 1134 amino acids; 129756 Da
Subunit: Interacts with TMEM30A, but not with TMEM30B
Subcellular location: Cell membrane; Multi-pass membrane protein. Early endosome. Recycling endosome. Endoplasmic
reticulum. Note=Exit from the endoplasmic reticulum requires the presence of TMEM30A, but not TMEM30B. In the
presence of TMEM30A, predominantly located in the plasma membrane
Secondary accessions: Q5VXT2

Explore the universe of human proteins at neXtProt for ATP11A: NX_P98196

Explore proteomics data for ATP11A at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_P98196

  • 4/15 DME Specific Peptides for ATP11A (P98196) (see all 15)
     GNWTFGT  LFEQFRR  LAIGDGA  TLAIGDG 

    ATP11A Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    ATP11A Protein Expression
    REFSEQ proteins (2 alternative transcripts): 
    NP_056020.2  NP_115565.3  

    ENSEMBL proteins: 
     ENSP00000420387   ENSP00000396374   ENSP00000420696   ENSP00000410824   ENSP00000402575  
     ENSP00000364781   ENSP00000364796   ENSP00000283558  
    Reactome Protein details: P98196
    Human Recombinant Protein Products for ATP11A: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for ATP11A
    GenScript Custom Purified and Recombinant Proteins Services for ATP11A
    Novus Biologicals ATP11A Protein
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for ATP11A 

    Gene Ontology (GO): 5/6 cellular component terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005765lysosomal membrane IDA17897319
    GO:0005769early endosome IEA--
    GO:0005783endoplasmic reticulum IDA--
    GO:0005886plasma membrane IEA--
    GO:0016021integral to membrane IEA--

    ATP11A for ontologies           About GeneDecksing



    ATP11A Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for ATP11A
    GenScript Custom Superior Antibodies Services for ATP11A
    Novus Biologicals ATP11A Antibodies
    Abcam antibodies for ATP11A
    Cloud-Clone Corp. Antibodies for ATP11A 
    ThermoFisher Antibodies for ATP11A
    LSBio Antibodies in human, mouse, rat for ATP11A 

    Assay Products for ATP11A: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for ATP11A
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ATP11A
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for ATP11A 
    Cloud-Clone Corp. CLIAs for ATP11A


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    HGNC Gene Families: 
    PATP: ATPases / P-type

    IUPHAR Guide to PHARMACOLOGY protein family classification: ATP11A 
    Phospholipid-transporting ATPase

    5/6 InterPro protein domains (see all 6):
     IPR023299 ATPase_P-typ_cyto_domN
     IPR008250 ATPase_P-typ_transduc_dom_A
     IPR023214 HAD-like_dom
     IPR006539 ATPase_P-typ_Plipid-transp
     IPR001757 Cation_transp_P_typ_ATPase

    Graphical View of Domain Structure for InterPro Entry P98196

    ProtoNet protein and cluster: P98196

    1 Blocks protein domain: IPB001757 ATPase

    UniProtKB/Swiss-Prot: AT11A_HUMAN, P98196
    Similarity: Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family. Type IV subfamily


    ATP11A for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: AT11A_HUMAN, P98196
    Catalytic activity: ATP + H(2)O + phospholipid(side 1) = ADP + phosphate + phospholipid(side 2)

         Enzyme Numbers (IUBMB): EC 3.6.3.11 2 EC 3.6.32

         Gene Ontology (GO): 5/7 molecular function terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000166nucleotide binding ----
    GO:0000287magnesium ion binding IEA--
    GO:0004012phospholipid-translocating ATPase activity IEA--
    GO:0005515protein binding IPI--
    GO:0005524ATP binding IEA--
         
    ATP11A for ontologies           About GeneDecksing


    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for ATP11A 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for ATP11A

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for ATP11A 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for ATP11A 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ATP11A
    8/90 QIAGEN miScript miRNA Assays for microRNAs that regulate ATP11A (see all 90):
    hsa-miR-549 hsa-miR-140-5p hsa-miR-323-3p hsa-miR-607 hsa-miR-3607-3p hsa-miR-106a hsa-miR-502-3p hsa-miR-10b*
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for ATP11A
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ATP11A

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ATP11A
    Sirion Biotech Customized adenovirus for overexpression of ATP11A

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for ATP11A (see all 11)
    OriGene ORF clones in mouse, rat for ATP11A
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): ATP11A (NM_015205)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ATP11A
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ATP11A
    Sirion Biotech Customized lentivirus for stable overexpression of ATP11A 
                         Customized lentivirus expression plasmids for stable overexpression of ATP11A 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ATP11A
    Search LifeMap BioReagents cell lines for ATP11A
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ATP11A


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for ATP11A About                                                                                                See pathways by source

    SuperPathContained pathways About
    1Ion channel transport
    Ion channel transport0.49
    Ion transport by P-type ATPases0.32
    2SLC-mediated transmembrane transport
    Transmembrane transport of small molecules0.50

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    3        Reactome Pathways for ATP11A
        Transmembrane transport of small molecules
    Ion channel transport
    Ion transport by P-type ATPases



    ATP11A for pathways           About GeneDecksing

    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for ATP11A

    STRING Interaction Network Preview (showing 1 interactants - click image to see more details)

    1 Interacting protein for ATP11A (ENSP000002835584) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    UBCENSP000003448184STRING: ENSP00000344818
    About this table

    Gene Ontology (GO): 3 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006812cation transport ----
    GO:0015914phospholipid transport ----
    GO:0045332phospholipid translocation NAS--

    ATP11A for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for ATP11A (AT11A)

    10/2605 HMDB Compounds for ATP11A (see all 2605)    About this table
    CompoundSynonyms CAS #PubMed Ids
    PC(O-16:0/18:2(9Z,12Z))1-hexadecyl-2-(9Z,12Z-octadecadienoyl)-sn-glycero-3-phosphocholine (see all 5)88542-95-412486725
    PE(O-16:1(1Z)/22:6(4Z,7Z,10Z,13Z,16Z,19Z))1-alkenyl-2-acyl-glycerophosphoethanolamine (see all 15)--12486725
    PE(O-18:1(1Z)/20:4(5Z,8Z,11Z,14Z))1-alkenyl-2-acyl-glycerophosphoethanolamine (see all 19)103597-60-012486725
    PE(P-16:0e/0:0)2-azaniumylethyl [(2R)-3-[(E)-hexadec-1-enoxy]-2-hydroxy-propyl] phosphate;1-(1Z-hexadecenyl)-sn-glycero-3-phosphoethanolamine ;LysoPE(dm16:0e) --12486725
    PE(P-16:0e/18:1(9Z))2-(9Z-octadecanoyl)-1-hexadecyl-sn-glycero-3-phosphoethanolamine --12486725
    ADPadenosindiphosphorsaeure (see all 8)58-64-0--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--
    PA(16:0/16:0)Dipalmitoylphosphatidic acid (see all 25)7091-44-3--
    PA(16:0/18:1(11Z))PA(16:0/18:1n7) (see all 10)----
    PA(16:0/18:1(9Z))PA(16:0/18:1n9) (see all 10)----

    Search CenterWatch for drugs/clinical trials and news about ATP11A / AT11A

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for ATP11A gene (2 alternative transcripts): 
    NM_015205.2  NM_032189.3  

    Unigene Cluster for ATP11A:

    ATPase, class VI, type 11A
    Hs.29189  [show with all ESTs]
    Unigene Representative Sequence: NM_015205
    16 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000487903 ENST00000419448 ENST00000466946 ENST00000459908(uc001vsm.1)
    ENST00000418678 ENST00000489577 ENST00000471555 ENST00000459011 ENST00000419631
    ENST00000495930 ENST00000493489 ENST00000415301 ENST00000479193 ENST00000375630(uc001vsj.4)
    ENST00000375645(uc001vsi.4 uc010ago.3) ENST00000283558
    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ATP11A
    8/90 QIAGEN miScript miRNA Assays for microRNAs that regulate ATP11A (see all 90):
    hsa-miR-549 hsa-miR-140-5p hsa-miR-323-3p hsa-miR-607 hsa-miR-3607-3p hsa-miR-106a hsa-miR-502-3p hsa-miR-10b*
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for ATP11A
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ATP11A
    Clone
    Products:
         
    OriGene clones in human, mouse for ATP11A (see all 11)
    OriGene ORF clones in mouse, rat for ATP11A
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): ATP11A (NM_015205)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ATP11A
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ATP11A
    Sirion Biotech Customized lentivirus for stable overexpression of ATP11A 
                         Customized lentivirus expression plasmids for stable overexpression of ATP11A 
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for ATP11A
    SABiosciences RT2 qPCR Primer Assay in human, mouse / rat ATP11A
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ATP11A
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ATP11A

    Additional mRNA sequence: 

    AB028944.2 AK024264.1 AK025511.1 AK091253.1 AL161996.1 BC008824.1 BC024154.2 BC035215.1 
    BC044649.1 

    12 DOTS entries:

    DT.101956757  DT.441976  DT.120784838  DT.100789013  DT.95193832  DT.430520  DT.95156275  DT.100789011 
    DT.95343104  DT.95358571  DT.99938048  DT.97825463 

    24/186 AceView cDNA sequences (see all 186):

    BU070690 AA235205 AI264584 AW629774 BG939369 AW068936 BM807197 AW068902 
    BM920369 AA235037 CB267821 BX356374 AA020973 AA348163 BU620537 AA347469 
    AI263969 CA435069 BE386361 BF515075 CF242832 AW298179 CA425028 BM783838 

    GeneLoc Exon Structure

    5/6 Alternative Splicing Database (ASD) splice patterns (SP) for ATP11A (see all 6)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23a · 23b ^
    SP1:                                                                                                                                                        -   
    SP2:                                                                                                                                                            
    SP3:                                                                                                                                                            
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            

    ExUns: 24 ^ 25a · 25b ^ 26a · 26b ^ 27a · 27b ^ 28a · 28b ^ 29 ^ 30a · 30b · 30c
    SP1:                    -                                                         
    SP2:                                                                              
    SP3:                                                                              
    SP4:                    -                       -     -     -                     
    SP5:                                                                              


    ECgene alternative splicing isoforms for ATP11A

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    ATP11A expression in normal human tissues (normalized intensities)      ATP11A embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: AATGGTATCC
    ATP11A Expression
    About this image


    ATP11A expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/4 selected tissues (see all 4) fully expand
     
     Brain (Nervous System)    fully expand to see all 5 entries
             ganglion/cranial/facial VII   
     
     Gut Tube (Gastrointestinal Tract)    fully expand to see all 2 entries
             Midgut
     
     Lower Urinary Tract (Urinary System)    fully expand to see all 2 entries
             visceral organ   
     
     Kidney (Urinary System)

    See ATP11A Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for ATP11A

    SOURCE GeneReport for Unigene cluster: Hs.29189
        SABiosciences Custom PCR Arrays for ATP11A
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for ATP11A
    SABiosciences RT2 qPCR Primer Assay in human, mouse / rat ATP11A
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ATP11A
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ATP11A
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ATP11A

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for ATP11A gene from 5/11 species (see all 11)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Atp11a1 , 5 ATPase, class VI, type 11A1, 5 83.35(n)1
    91.09(a)1
      8 (5.73 cM)5
    507701  NM_015804.31  NP_056619.11 
     127570145 
    chicken
    (Gallus gallus)
    Aves ATP11A1 ATPase, class VI, type 11A 76.73(n)
    86.92(a)
      418749  XM_416948.3  XP_416948.3 
    lizard
    (Anolis carolinensis)
    Reptilia ATP11A6
    ATPase, class VI, type 11A
    81(a)
    1 ↔ 1
    3(105622834-105763922)
    zebrafish
    (Danio rerio)
    Actinopterygii atp11a1 ATPase, class VI, type 11A 75.33(n)
    83.58(a)
      562925  XM_686290.3  XP_691382.3 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG43013 calcium-transporting ATPase 38(a)
    (best of 2)
      14C4   --


    ENSEMBL Gene Tree for ATP11A (if available)
    TreeFam Gene Tree for ATP11A (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for ATP11A gene
    ATP8A12  ATP11C2  ATP11B2  ATP8A22  ATP8B42  ATP8B22  
    13 SIMAP similar genes for ATP11A using alignment to 9 protein entries:     AT11A_HUMAN (see all proteins):
    DKFZp434P0831    ATP11C    DKFZp779H1459    ATP11B    ATP8B4    ATP8A1
    ATP10A    ATP8B2    ATP8A2    ATP8B1    ATP8B3    ATP9B
    ATP9A

    ATP11A for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/5981 SNPs in ATP11A are shown (see all 5981)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 13 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs711015361,2
    C,F--94455882(+) AGTGC-/AGGCCTGC/AGGCCTGCGCAGCTTCCCAGCGGGGT
    CCATCACCACCTGCGCAGTAATTCAGTGC
    /GGCCCAT
    GGCCC
    2 -- int12NA 4
    rs38329101,2
    C--94479147(+) CTCCC-/CTGAGTT 2 -- ut312Minor allele frequency- CT:0.25NA 4
    rs1906835011,2
    --113342725(+) AGTCAC/TGGTTT 2 -- us2k10--------
    rs1395969101,2
    --113342726(+) GTCACA/GGTTTA 2 -- us2k10--------
    rs1408369441,2
    C--113342878(+) AAGGG-/TGCTGCTA 2 -- us2k10--------
    rs593342501,2
    C,F--113342912(+) CAGACC/TGACAA 2 -- us2k13Minor allele frequency- T:0.19WA CSA 122
    rs1817818091,2
    C--113342943(+) TTGGGA/GGCGGG 2 -- us2k10--------
    rs1865108951,2
    --113342971(+) GAGCCC/TAGAGG 2 -- us2k10--------
    rs1493361101,2
    --113342999(+) GGCACC/TCAGGA 2 -- us2k10--------
    rs1909070701,2
    --113343033(+) CCAACA/CCTGGT 2 -- us2k10--------

    HapMap Linkage Disequilibrium report for ATP11A (113344643 - 113541482 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 10/98 variations for ATP11A (see all 98):    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2748190CNV Deletion23290073
    esv2748176CNV Deletion23290073
    esv2748184CNV Deletion23290073
    esv2748171CNV Deletion23290073
    esv1707874CNV Deletion17803354
    esv1002642CNV Deletion20482838
    esv2748172CNV Deletion23290073
    esv2748203CNV Deletion23290073
    esv2748192CNV Deletion23290073
    esv2099073CNV Deletion18987734

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing ATP11A
    DNA2.0 Custom Variant and Variant Library Synthesis for ATP11A

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 605868    OMIM disorders: --

    4 diseases for ATP11A:    About MalaCards
    toxic myocarditis    hypoparathyroidism    myocarditis    colorectal cancer


    ATP11A for disorders           About GeneDecksing

    Genetic Association Database (GAD): ATP11A
    Human Genome Epidemiology (HuGE) Navigator: ATP11A (2 documents)

    Export disorders for ATP11A gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for ATP11A gene, integrated from 9 sources (see all 18):
    (articles sorted by number of sources associating them with ATP11A)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. ATP9B, a P4-ATPase (a putative aminophospholipid translocase), localizes to the trans-Golgi network in a CDC50 protein-independent manner. (PubMed id 21914794)1, 2 Takatsu H.... Shin H.W. (2011)
    2. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (2010)
    3. The DNA sequence and analysis of human chromosome 13. (PubMed id 15057823)1, 2 Dunham A.... Ross M.T. (2004)
    4. Prediction of the coding sequences of unidentified human genes. XIV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PubMed id 10470851)1, 2 Kikuno R....Ohara O. (1999)
    5. Differential expression of putative transbilayer amphipath transporters. (PubMed id 11015572)1, 3 Halleck M.S.... Schlegel R.A. (1999)
    6. Genome-wide association study identifies multiple susc eptibility loci for pulmonary fibrosis. (PubMed id 23583980)1 Fingerlin T.E....Schwartz D.A. (2013)
    7. Systems-wide analysis of ubiquitylation dynamics reveals a key role for PAF15 ubiquitylation in DNA-damage bypass. (PubMed id 23000965)1 Povlsen L.K....Choudhary C. (2012)
    8. A proteome-wide, quantitative survey of in vivo ubiqui tylation sites reveals widespread regulatory roles. (PubMed id 21890473)1 Wagner S.A....Choudhary C. (2011)
    9. Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (2011)
    10. Mass spectrometric analysis of lysine ubiquitylation r eveals promiscuity at site level. (PubMed id 21139048)1 Danielsen J.M....Nielsen M.L. (2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 23250 HGNC: 13552 AceView: ATP11A Ensembl:ENSG00000068650 euGenes: HUgn23250
    ECgene: ATP11A H-InvDB: ATP11A

    (According to HUGE)
    About This Section
    HUGE: KIAA1021

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for ATP11A Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for ATP11A gene:
    Search GeneIP for patents involving ATP11A

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for ATP11A  
     Browse OriGene qPCR primer pairs and template standards   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for ATP11A  
     OriGene qSTAR qPCR primer pairs in human, mouse for ATP11A   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for ATP11A   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ATP11A   OriGene Custom Protein Services for ATP11A  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ATP11A
     QIAGEN SeqTarget long-range PCR primers for resequencing ATP11A
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ATP11A
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ATP11A
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ATP11A
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ATP11A
     GenScript Custom Purified and Recombinant Proteins Services for ATP11A GenScript cDNA clones with any tag delivered in your preferred vector for ATP11A
     GenScript Custom Assay Services for ATP11A GenScript Custom Superior Antibodies Services for ATP11A
     GenScript Custom overexpressing Cell Line Services for ATP11A CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in ATP11A promoter
     Search Chromatin IP Primers for ATP11A
     RT2 qPCR Primer Assay in human, mouse / rat ATP11A
     Search GNC Networks for ATP11A
     SABiosciences Custom PCR Arrays for ATP11A
     Search Tocris compounds for ATP11A (AT11A)
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     ATP11A antibodies
     ATP11A proteins
     Antibodies for ATP11A
     See all of Abcam's Antibodies, Kits and Proteins for ATP11A
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for ATP11A
     Antibodies for ATP11A
     ELISAs for ATP11A
     CLIAs for ATP11A
     Search LifeMap BioReagents cell lines for ATP11A
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ATP11A
     Browse SwitchGear 3'UTR luciferase reporter plasmids for ATP11A
     SwitchGear Promoter luciferase reporter plasmids for ATP11A
     ThermoFisher Antibodies for ATP11A
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ATP11A
     inGenious Targeting Laboratory - Custom generated mouse model solutions for ATP11A
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for ATP11A
    Customized:
     lentivirus for stable overexpression of ATP11A
     lentivirus expression plasmids for stable overexpression of ATP11A
     adenovirus for overexpression of ATP11A
     LSBio Antibodies in human, mouse, rat for ATP11A
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ATP11A gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4