Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms of Use
- Terms of Use
- 3rd Party Notice
About Us
- GeneCards Team
- Our Publications
- Citing GeneCards
- Licensing Agreement
- Weizmann Institute
- LifeMap Sciences Inc
User Feedback
GeneCards Plus
- Premium Tools
  
  Learn more

Set Analyses:

VarElect

Advanced Search

ASPH Gene

protein-coding GIFtS: 60
GCID: GC08M062465

Aspartate Beta-Hydroxylase

Alzheimer's & Parkinson's Diseases Congress

See related diseases
at

MalaCards

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, ¹⁰fRNAdb, ¹²H-InvDB, ¹³NCBI, ¹⁴NONCODE, and/or ¹⁵RNAdb)
About This Section

TryGeneCards Plus

Aliases
Aspartate Beta-Hydroxylase¹ ² ³		BAH²
humbug¹ ²		CASQ2BP1²
junctate¹ ²		JCTN²
junctin¹ ²		A Beta H-J-J²
Peptide-Aspartate Beta-Dioxygenase² ³		Aspartyl/Asparaginyl Beta-Hydroxylase²
ASP Beta-Hydroxylase² ³		aspartyl/asparaginyl-beta-hydroxylase²
HAAH² ⁵		Cardiac Junctin²
AAH²		EC 1.14.11.16³

External Ids:	HGNC: 757¹	Entrez Gene: 444²	Ensembl: ENSG00000198363⁷	OMIM: 600582⁵	UniProtKB: Q12797³

Export aliases for ASPH gene to outside databases

Previous GC identifers: GC08M061782 GC08M062355 GC08M062138 GC08M062578 GC08M057901

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for ASPH Gene:

This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters

and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near

their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional

properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that

hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some

proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other

isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been

localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with

calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the

sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. (provided by RefSeq, Sep 2009)

GeneCards Summary for ASPH Gene:

ASPH (aspartate beta-hydroxylase) is a protein-coding gene. Diseases associated with ASPH include regular astigmatism, and catecholaminergic polymorphic ventricular tachycardia. GO annotations related to this gene include electron carrier activity and calcium ion binding. An important paralog of this gene is ASPHD2.

UniProtKB/Swiss-Prot: ASPH_HUMAN, Q12797

Function: Isoform 1: specifically hydroxylates an Asp or Asn residue in certain epidermal growth factor-like (EGF)

domains of a number of proteins

Function: Isoform 8: membrane-bound Ca(2+)-sensing protein, which is a structural component of the ER-plasma

membrane junctions. Isoform 8 regulates the activity of Ca(+2) released-activated Ca(+2) (CRAC) channels in

T-cells

Gene Wiki entry for ASPH Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus

RefSeq DNA sequence:

NC_000008.11 NT_008183.20 NC_018919.2

Regulatory elements:

Regulatory transcription factor binding sites in the ASPH gene promoter:
c-Fos GR AP-1 JunB GR-beta Fra-1 FosB GATA-2 GR-alpha c-Jun
Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): ASPH promoter sequence

Search Chromatin IP Primers for ASPH

Epigenetics:

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ASPH

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 8q12.1 Ensembl cytogenetic band: 8q12.3 HGNC cytogenetic band: 8q12.1

ASPH Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ASPH gene location

GeneLoc information about chromosome 8 GeneLoc Exon Structure

GeneLoc location for GC08M062465: view genomic region (about GC identifiers)

Start:	62,413,115 bp from pter	End:	62,627,199 bp from pter
Size:	214,085 bases	Orientation:	minus strand

(According to ¹UniProtKB, HORDE, ²neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: ASPH_HUMAN, Q12797 (See protein sequence)

Recommended Name: Aspartyl/asparaginyl beta-hydroxylase

Size: 758 amino acids; 85863 Da

Cofactor: Iron

Subunit: Monomer (By similarity). Isoform 8 interacts with ORAI1 and STIM1

1 PDB 3D structure from and Proteopedia for ASPH:

3RCQ (3D)

Secondary accessions: A6NDF4 A6NHI2 B4DIC9 B4E2K4 B7ZM95 E5RGP5 F5H667 Q6NXR7 Q8TB28 Q9H291

Q9H2C4 Q9NRI0 Q9NRI1 Q9Y4J0

Alternative splicing: 10 isoforms: Q12797-1 Q12797-2 Q12797-3 Q12797-4 Q12797-5 Q12797-10 Q12797-6 Q12797-7

Q12797-8 Q12797-9 (Glycosylated on Asn-64)

Explore the universe of human proteins at neXtProt for ASPH: NX_Q12797

Explore proteomics data for ASPH at MOPED

Post-translational modifications:

Glycosylation² at Asn452, Asn706

Modification sites at PhosphoSitePlus

See ASPH Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

REFSEQ proteins (12 alternative transcripts):

NP_001158222.1 NP_001158223.1 NP_001158224.1 NP_001158225.1 NP_001158226.1 NP_001158227.1 NP_001158228.1 NP_004309.2

NP_064549.1 NP_115855.1 NP_115856.1 NP_115857.1

ENSEMBL proteins:

ENSP00000368767 ENSP00000429718 ENSP00000430516 ENSP00000348841 ENSP00000427823

ENSP00000429286 ENSP00000430245 ENSP00000429954 ENSP00000429160 ENSP00000427877

ENSP00000429743 ENSP00000373856 ENSP00000436188 ENSP00000368762 ENSP00000428060

ENSP00000437864 ENSP00000394013

ASPH Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	OriGene Purified Proteins for ASPH OriGene Protein Over-expression Lysate for ASPH OriGene MassSpec for ASPH OriGene Custom Protein Services for ASPH
	GenScript Custom Purified and Recombinant Proteins Services for ASPH
	Novus Biologicals ASPH Proteins Novus Biologicals ASPH Lysates
	Browse Sino Biological Recombinant Proteins Browse Sino Biological Cell Lysates
	ProSpec Recombinant Protein for ASPH
	Cloud-Clone Corp. Proteins for ASPH

ASPH Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for ASPH
	Novus Biologicals ASPH Antibodies
	Abcam antibodies for ASPH
	Cloud-Clone Corp. Antibodies for ASPH
	Search ThermoFisher Antibodies for ASPH
	LSBio Antibodies in human, mouse, rat for ASPH

ASPH Assay Products:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Assay Services for ASPH
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for ASPH
	Browse Enzo Life Sciences for kits & assays
	Cloud-Clone Corp. ELISAs for ASPH Cloud-Clone Corp. CLIAs for ASPH

(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

TryGeneCards Plus

Selected InterPro protein domains (see all 6):

IPR007943 Asp-B-hydro/Triadin_dom

IPR007803 Asp_Arg_Pro-Hydrxlase

IPR027443 IPNS-like

IPR011990 TPR-like_helical

IPR013026 TPR-contain_dom

Graphical View of Domain Structure for InterPro Entry Q12797

ProtoNet protein and cluster: Q12797

UniProtKB/Swiss-Prot: ASPH_HUMAN, Q12797

Similarity: Belongs to the aspartyl/asparaginyl beta-hydroxylase family

Similarity: Contains 4 TPR repeats

ASPH for domains About GeneDecksing

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Molecular Function:

UniProtKB/Swiss-Prot Summary: ASPH_HUMAN, Q12797

Function: Isoform 1: specifically hydroxylates an Asp or Asn residue in certain epidermal growth factor-like (EGF)

domains of a number of proteins

Function: Isoform 8: membrane-bound Ca(2+)-sensing protein, which is a structural component of the ER-plasma

membrane junctions. Isoform 8 regulates the activity of Ca(+2) released-activated Ca(+2) (CRAC) channels in

T-cells

Catalytic activity: Peptide L-aspartate + 2-oxoglutarate + O(2) = peptide 3-hydroxy-L-aspartate + succinate +

CO(2)

Enzyme Number (IUBMB): EC 1.14.11.16¹

Gene Ontology (GO): Selected molecular function terms (see all 7): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0004597	peptide-aspartate beta-dioxygenase activity	IEA	--
GO:0005198	structural molecule activity	TAS	11007777
GO:0005509	calcium ion binding	NAS	11007777
GO:0005515	protein binding	IPI	--
GO:0008307	structural constituent of muscle	TAS	11007777

ASPH for ontologies About GeneDecksing

Phenotypes:
1 GenomeRNAi human phenotype for ASPH:

Synthetic lethal with Ras

9 MGI mutant phenotypes (inferred from 2 alleles) (MGI details for Asph):

cardiovascular system	craniofacial	digestive/alimentary	homeostasis/metabolism	limbs/digits/tail
mortality/aging	muscle	reproductive system	tumorigenesis

ASPH for phenotypes About GeneDecksing

Animal Models:
MGI mouse knock-outs for ASPH: Asph^tm1Egk Asph^tm1Jed

inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ASPH

inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ASPH

genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for ASPH

genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for ASPH

miRNA Products:		miRTarBase miRNAs that target ASPH: hsa-mir-215-5p (MIRT024363), hsa-mir-16-5p (MIRT031802), hsa-mir-192-5p (MIRT026731), hsa-mir-155-5p (MIRT020908)

		Block miRNA regulation of human, mouse, rat ASPH using miScript Target Protectors
		Selected qRT-PCR Assays for microRNAs that regulate ASPH (see all 62):
		hsa-miR-3152-3p hsa-miR-429 hsa-miR-15a hsa-miR-513a-5p hsa-miR-25 hsa-miR-29a hsa-miR-486-3p hsa-miR-183*

		SwitchGear 3'UTR luciferase reporter plasmid: ASPH 3' UTR sequence

Inhib. RNA Products:		OriGene RNAi products in human, mouse, rat for ASPH
		Predesigned siRNA for gene silencing in human, mouse, rat ASPH

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for ASPH

Clone Products:		OriGene clones in human, mouse for ASPH (see all 74) OriGene ORF clones in mouse, rat for ASPH OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 12): ASPH (NM_032466)
		Sino Biological Human cDNA Clone for ASPH
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for ASPH
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ASPH

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for ASPH
		Browse ESI BIO Cell Lines and PureStem Progenitors for ASPH

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ASPH

(According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Subcellular locations from UniProtKB/Swiss-Prot

ASPH_HUMAN, Q12797: Isoform 1: Endoplasmic reticulum membrane; Single-pass type II membrane protein

ASPH_HUMAN, Q12797: Isoform 8: Endoplasmic reticulum membrane; Single-pass type II membrane protein

Subcellular locations from COMPARTMENTS:

Compartment	Confidence
endoplasmic reticulum	5
plasma membrane	5
cytosol	2
mitochondrion	1
nucleus	1

About this image

Gene Ontology (GO): Selected cellular component terms (see all 12): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005737	cytoplasm	--	--
GO:0005783	endoplasmic reticulum	IDA	--
GO:0005789	endoplasmic reticulum membrane	NAS	11007777
GO:0005886	plasma membrane	IDA	--
GO:0014701	junctional sarcoplasmic reticulum membrane	TAS	17569730

ASPH for ontologies About GeneDecksing

(SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
About This Section

TryGeneCards Plus

Custom Pathway & Disease-focused RT² Profiler PCR Arrays for ASPH
Interactions:

GeneGlobe Interaction Network for ASPH

STRING Interaction Network Preview (showing 5 interactants - click image to see 6)

Selected Interacting proteins for ASPH (Q12797³ ENSP00000368767⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 15)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
SQSTM1	Q13501³, ENSP00000374455⁴	I2D: score=3 STRING: ENSP00000374455
DDA1	Q9BW61³	I2D: score=1
GABARAPL1	Q9H0R8³	I2D: score=1
GABARAPL2	P60520³	I2D: score=1
GBAS	O75323³	I2D: score=1

About this table

Gene Ontology (GO): Selected biological process terms (see all 26): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005513	detection of calcium ion	TAS	--
GO:0006936	muscle contraction	TAS	10974562
GO:0007389	pattern specification process	IEA	--
GO:0008285	negative regulation of cell proliferation	IEA	--
GO:0010524	positive regulation of calcium ion transport into cytosol	IDA	--

ASPH for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
About This Section

TryGeneCards Plus

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse compounds at ApexBio

Browse Tocris compounds for ASPH

6 HMDB Compounds for ASPH About this table

Compound	Synonyms	CAS #	PubMed Ids
Carbon dioxide	Carbon oxide (see all 5)	124-38-9	--
Iron	Armco iron (see all 19)	7439-89-6	--
L-Aspartic acid	(+)-Aspartate (see all 41)	56-84-8	--
Oxoglutaric acid	2-Ketoglutarate (see all 9)	328-50-7	--
Oxygen	Oxygen (see all 5)	7782-44-7	--
Succinic acid	1,2-Ethanedicarboxylate (see all 11)	110-15-6	--

2 DrugBank Compounds for ASPH About this table

Compound	Synonyms	CAS #	Type	Actions	PubMed Ids
L-Aspartic Acid	(+)-Aspartic acid (see all 23)	56-84-8	target	--	6785382 17139284 17016423 403177
Succinic acid	1,2-Ethanedicarboxylic acid (see all 8)	110-15-6	target	--	17139284 17016423

3 Novoseek inferred chemical compound relationships for ASPH gene About this table

Compound	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
ryanodine	83.4	40	19398037 (6), 19230141 (5), 9287354 (4), 15731387 (2) (see all 16)
calcium	52.3	54	19230141 (7), 18620751 (6), 15731387 (2), 15050380 (2) (see all 15)
dihydropyridine	35.2	1	12959958 (1)

ASPH for compounds About GeneDecksing

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
About This Section

TryGeneCards Plus

REFSEQ mRNAs for ASPH gene (12 alternative transcripts):

NM_001164750.1 NM_001164751.1 NM_001164752.1 NM_001164753.1 NM_001164754.1 NM_001164755.1 NM_001164756.1 NM_004318.3

NM_020164.4 NM_032466.3 NM_032467.3 NM_032468.4

Unigene Cluster for ASPH:

Aspartate beta-hydroxylase

Hs.332422 [show with all ESTs]

Unigene Representative Sequence: NM_004318

Selected Ensembl transcripts including schematic representations, and UCSC links where relevant (see all 30):

ENST00000379454(uc003xuo.2) ENST00000521909 ENST00000524173 ENST00000521499

ENST00000522349 ENST00000523897 ENST00000523927 ENST00000522919 ENST00000356457(uc003xum.3 uc003xun.3 uc011lek.2)

ENST00000519234 ENST00000518068 ENST00000517903(uc003xul.3 uc011lei.2 uc011lej.2 uc011leh.2)

ENST00000517847 ENST00000518441 ENST00000522835 ENST00000519678 ENST00000519264

ENST00000518306

miRNA Products:		Block miRNA regulation of human, mouse, rat ASPH using miScript Target Protectors
		Selected qRT-PCR Assays for microRNAs that regulate ASPH (see all 62):
		hsa-miR-3152-3p hsa-miR-429 hsa-miR-15a hsa-miR-513a-5p hsa-miR-25 hsa-miR-29a hsa-miR-486-3p hsa-miR-183*

		SwitchGear 3'UTR luciferase reporter plasmid: ASPH 3' UTR sequence

Inhib. RNA Products:		OriGene RNAi products in human, mouse, rat for ASPH
		Predesigned siRNA for gene silencing in human, mouse, rat ASPH

Clone Products:		OriGene clones in human, mouse for ASPH (see all 74) OriGene ORF clones in mouse, rat for ASPH OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 12): ASPH (NM_032466)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for ASPH
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ASPH

Primer Products:		OriGene qPCR primer pairs and template standards for ASPH OriGene qSTAR qPCR primer pairs in human, mouse for ASPH
		Pre-validated RT² qPCR Primer Assay in human, mouse, rat ASPH
		QuantiTect SYBR Green Assays in human, mouse, rat ASPH
		QuantiFast Probe-based Assays in human, mouse, rat ASPH

Additional mRNA sequence:

AF086211.1 AF184241.1 AF224468.1 AF224469.1 AF289489.1 AF306765.1 AF339775.1 AK096383.1

AK291836.1 AK295528.1 AK298577.1 AK304314.1 BC015518.2 BC025236.1 BC066929.1 BC142967.1

BC144362.1 BC144363.1 EU718494.1 FJ461473.1 S83325.1 U03109.1

Selected DOTS entries (see all 46):

DT.95137827 DT.75142168 DT.100828247 DT.97791318 DT.91747937 DT.100717633 DT.121476279 DT.91806352

DT.100031688 DT.100828251 DT.101983609 DT.75144670 DT.121476264 DT.100828250 DT.100031678 DT.91771048

DT.91838855 DT.121476378 DT.91771045 DT.92395560 DT.110348 DT.121476242 DT.95137817 DT.97860729

Selected AceView cDNA sequences (see all 558):

BM806632 BM795015 CA420254 CR614279 AF339775 CA420566 AW612493 CD722024

BX479249 BQ018990 BM851748 BE544061 AA602346 BM756128 BF590643 BG249108

BE550654 CB122028 AU132666 BC025236 BM354082 BF591055 BM785890 BX477471

GeneLoc Exon Structure

5 Alternative Splicing Database (ASD) splice patterns (SP) for ASPH About this scheme

ExUns:	1a	·	1b	·	1c	^	2	^	3	^	4	^	5a	·	5b	^	6	^	7	^	8a	·	8b	^	9
SP1:							-								-		-
SP2:							-				-				-		-
SP3:							-								-
SP4:											-				-		-		-		-		-
SP5:											-

ECgene alternative splicing isoforms for ASPH

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE ¹MOPED, ²PaxDb, and ³MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

TryGeneCards Plus

ASPH expression in normal human tissues (normalized intensities) ASPH embryonic expression: see
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>^2/3
CGAP TAG: GGTACTCGAT

About this image

ASPH expression in embryonic tissues and stem cells About this table

Data from LifeMap, the Embryonic Development and Stem Cells Database
selected tissues (see all 3) fully expand


NULL (Uncategorized)
Adipose-derived stromal vascular fraction and adipocytes (HiQCell)

Blood (Hematopoietic System)
Proerythroblasts Hematopoietic Bone Marrow

Skeletal Muscle (Muscoskeletal System)

ASPH Protein expression data from MOPED¹, PaxDb² and MaxQB³:

About this image

ASPH Protein Expression

SOURCE GeneReport for Unigene cluster: Hs.332422

UniProtKB/Swiss-Prot: ASPH_HUMAN, Q12797

Tissue specificity: Isoform 1 is detected in all tissues tested. Isoform 8 is mainly expressed in pancreas, heart,

brain, kidney and liver. Isoform 8 is expressed in kidney (at protein level)

Custom PCR Arrays for ASPH

Primer Products:		OriGene qPCR primer pairs and template standards for ASPH OriGene qSTAR qPCR primer pairs in human, mouse for ASPH
		Pre-validated RT² qPCR Primer Assay in human, mouse, rat ASPH
		QuantiTect SYBR Green Assays in human, mouse, rat ASPH
		QuantiFast Probe-based Assays in human, mouse, rat ASPH

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ASPH

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

TryGeneCards Plus

This gene was present in the common ancestor of animals.

Orthologs for ASPH gene from Selected species (see all 14) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
mouse (Mus musculus)	Mammalia	Asph^{1 , 5}	aspartate-beta-hydroxylase^{1, 5}	82.9(n)¹ 84(a)¹		4 (4.17 cM)⁵ 65973¹ NM_023066.3¹ NP_075553.2¹ 9448069⁵
chicken (Gallus gallus)	Aves	ASPH¹	aspartate beta-hydroxylase	70.7(n) 70.24(a)		421142 XM_004939873.1 XP_004939930.1
lizard (Anolis carolinensis)	Reptilia	ASPH⁶	aspartate beta-hydroxylase	60(a)	1 ↔ 1	4(28939423-29054740)
African clawed frog (Xenopus laevis)	Amphibia	Xl.1434²	Xenopus laevis transcribed sequence with weak similarity more	74.89(n)		BG552949.1
zebrafish (Danio rerio)	Actinopterygii	ASPH⁶	aspartate beta-hydroxylase	73(a)	1 ↔ 1	7(59431589-59452320) ENSDARG00000078703
fruit fly (Drosophila melanogaster)	Insecta	Asph⁶	Aspartyl beta-hydroxylase	28(a)	1 → many	2R(11997990-12004501)
worm (Caenorhabditis elegans)	Secernentea	K09A9.6⁶	Protein K09A9.6, isoform b	16(a)	1 → many	X(15577470-15586816) WBGene00010703

ENSEMBL Gene Tree for ASPH (if available)
TreeFam Gene Tree for ASPH (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

TryGeneCards Plus

Paralogs for ASPH gene

ASPHD2² ASPHD1²

ASPH for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, ⁴UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
About This Section

TryGeneCards Plus

SNP ID	Valid	Clinical significance	Chr 8 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs78693373^1,2	C	--	57908702(+)	`GAAAGA/GATGTT`	2	--	int¹		0	--	--	--	--
rs61000478^1,2	C	--	57908706(+)	`GGATGAATG/- TTTTT`	2	--	int¹		1		NA	2
rs34427275^1,2	C	--	57909385(+)	`TAAGA-/G/GA AGAAA`	2	--	int¹		1		NA	2
rs146268091^1,2	C	--	57920722(+)	`TGTGG-/GGAGAGGA`	2	--	cds¹		0	--	--	--	--
rs199716362^1,2		--	57924367(+)	`TTTCT-/TTCTTTTT`	2	--	int¹		0	--	--	--	--
rs112085568^1,2	C	--	57924373(+)	`TCTTTC/TTTTTT`	2	--	int¹		1		NA	2
rs75259009^1,2	C	--	57963807(+)	`AAAGT-/GAGT AATTT`	2	--	int¹		0	--	--	--	--
rs148152509^1,2	C	--	57967151(+)	`ATCAT-/TGATGAAGTGATCTAC ACTAAACAGCTAAGATCACTGATG`	2	--	int¹		0	--	--	--	--
rs7462502^1,2	C	--	57967185(+)	`gatcaC/Ttgatg`	2	--	int¹		1		WA	2
rs11406205^1,2	C	--	57978875(+)	`ATGACA/-AAAAA`	2	--	int¹ trp³		1		CSA	2

HapMap Linkage Disequilibrium report for ASPH (62413115 - 62627199 bp)

Structural Variations
Database of Genomic Variants (DGV) 7 variations for ASPH: About this table

Variant ID	Type	Subtype	PubMed ID
esv2662959	CNV	Deletion	23128226
esv1949409	CNV	Deletion	18987734
esv2737080	CNV	Deletion	23290073
esv2737081	CNV	Deletion	23290073
nsv890950	CNV	Loss	21882294
esv22699	CNV	Loss	19812545
nsv521898	CNV	Gain	19592680

Human Gene Mutation Database (HGMD): ASPH

Site Specific Mutation Identification with PCR Assays

SeqTarget long-range PCR primers for resequencing ASPH

DNA2.0 Custom Variant and Variant Library Synthesis for ASPH

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

TryGeneCards Plus

OMIM gene information: 600582 OMIM disorders: --

20 diseases for ASPH: About MalaCards

regular astigmatism catecholaminergic polymorphic ventricular tachycardia malignant hyperthermia susceptibility astigmatism

malignant hyperthermia conn's syndrome cholangiocarcinoma alcoholic hepatitis

pregnancy loss intrahepatic cholangiocarcinoma bipolar disorder hepatocellular carcinoma

myopathy type 1 diabetes neuroblastoma schizophrenia

hypoxia hepatitis malaria neuronitis

1 disease from the University of Copenhagen DISEASES database for ASPH:

Regular astigmatism

ASPH for disorders About GeneDecksing

Congresses - knowledge worth sharing:
Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015

5 Novoseek inferred disease relationships for ASPH gene About this table

Disease	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
arrhythmia	40	2	19286959 (2)
cholangiocarcinoma	39.8	3	10728685 (2), 19663697 (1)
heart failure	31.8	4	17400717 (3), 19403607 (1)
hepatocellular carcinoma	18.7	4	19663697 (2), 10728685 (1), 16564107 (1)
tumors	0	12	18334751 (2), 20230674 (2), 19663697 (1), 17156427 (1) (see all 5)

Genetic Association Database (GAD): ASPH

Export disorders for ASPH gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

TryGeneCards Plus

PubMed articles for ASPH gene, integrated from 10 sources (see all 103):
(articles sorted by number of sources associating them with ASPH)

Utopia: connect your pdf to the dynamic
world of online information

cDNA cloning and characterization of human cardiac junctin. (PubMed id 10974562)^{1, 2, 3, 9} Lim K.Y.... Kim D.H. (Gene 2000)
Cloning and characterization of the human gene encoding aspartyl beta-hydroxylase. (PubMed id 7821814)^{1, 2, 3, 9} Korioth F.... Frey J. (Gene 1994)
Aspartyl beta -hydroxylase (Asph) and an evolutionarily conserved isoform of Asph missing the catalytic domain share exons with junctin. (PubMed id 10956665)^{1, 2, 9} Dinchuk J.E....Friedman P.A. (J. Biol. Chem. 2000)
Molecular cloning of junctin from human and developing rabbit heart. (PubMed id 10767180)^{1, 2, 9} Wetzel G.T.... Chen F. (Mol. Genet. Metab. 2000)
Molecular cloning, expression, functional characterization, chromosomal localization, and gene structure of junctate, a novel integral calcium binding protein of sarco(endo)plasmic reticulum membrane. (PubMed id 11007777)^{1, 2, 9} Treves S.... Zorzato F. (J. Biol. Chem. 2000)
Junctate is a Ca2+-sensing structural component of Orai1 and stromal interaction molecule 1 (STIM1). (PubMed id 22586105)^{1, 2} Srikanth S.... Gwack Y. (Proc. Natl. Acad. Sci. U.S.A. 2012)
Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)^{1, 2} Ota T.... Sugano S. (Nat. Genet. 2004)
Overexpression of human aspartyl(asparaginyl)beta-hydroxylase in hepatocellular carcinoma and cholangiocarcinoma. (PubMed id 8823296)^{1, 2} Lavaissiere L.... Friedman P.A. (J. Clin. Invest. 1996)
On the role of junctin in cardiac Ca2+ handling, contractility, and heart failure. (PubMed id 17400717)^{1, 9} Gergs U....Neumann J. (Am. J. Physiol. Heart Circ. Physiol. 2007)
Complex formation between junctin, triadin, calsequestrin, and the ryanodine receptor. Proteins of the cardiac junctional sarcoplasmic reticulum membrane. (PubMed id 9287354)^{1, 9} Zhang L....Jones L.R. (J. Biol. Chem. 1997)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

TryGeneCards Plus

		AND	OR
Aliases
Disorders
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

TryGeneCards Plus

Entrez Gene: 444	HGNC: 757	AceView: ASPH	Ensembl:ENSG00000198363	euGenes: HUgn444
ECgene: ASPH	H-InvDB: ASPH

(According to HUGE)
About This Section

TryGeneCards Plus

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
About This Section

TryGeneCards Plus

Name	Description
PharmGKB entry for ASPH	Pharmacogenomics, SNPs, Pathways
ATLAS Chromosomes in Cancer entry for ASPH	Genetics and Cytogenetics in Oncology and Haematology

Intellectual Property for ASPH gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

TryGeneCards Plus

Patent Information for ASPH gene:
Search GeneIP for patents involving ASPH

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section

TryGeneCards Plus


	EMD Millipore genomic analysis products

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Enzyme Activity Assays/Reagents
	Browse ELISpot/FluoroSpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Luminex Assays
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Recombinant/Natural Proteins		Browse Stem Cell Products
	Browse cDNA Clones		Browse Proteome Profiler Antibody Arrays

	Browse OriGene Antibodies		OriGene RNAi products in human, mouse, rat for ASPH
	OriGene qPCR primer pairs and template standards for ASPH		OriGene Protein Over-expression Lysate for ASPH
	OriGene MassSpec something-or-other for ASPH		OriGene clones in human, mouse for ASPH
	OriGene qSTAR qPCR primer pairs in human, mouse for ASPH		OriGene Purified Protein for ASPH
	OriGene ORF clones in mouse, rat for ASPH		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for ASPH		OriGene Custom Protein Services for ASPH

	Block miRNA regulation of human, mouse, rat ASPH using miScript Target Protectors		SeqTarget long-range PCR primers for resequencing ASPH
	DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ASPH		Predesigned siRNA for gene silencing in human, mouse, rat ASPH
	QuantiFast Probe-based Assays in human, mouse, rat ASPH		QuantiTect SYBR Green Assays in human, mouse, rat ASPH
	Custom PCR Arrays for ASPH		Search Chromatin IP Primers for ASPH
	Pre-validated RT² qPCR Primer Assay in human, mouse, rat ASPH		GeneGlobe Interaction Network for ASPH
	Regulatory tfbs in ASPH promoter

	GenScript Custom Purified and Recombinant Proteins Services for ASPH		GenScript cDNA clones with any tag delivered in your preferred vector for ASPH
	GenScript Custom Assay Services for ASPH		GenScript Custom overexpressing Cell Line Services for ASPH
	CloneReady with Over 120,000 Genes		Gene Synthesis: Any Gene in Any Vector
	Vector-based siRNA and miRNA, Ready for Transfection		Gene Mutant Library, Variants up to 10^11
	Plasmid Preparation		Custom Peptide Services

Search for Antibodies & Assays

Search Tocris compounds for ASPH

	Browse Sino Biological Proteins
	Browse Sino Biological Cell Lysates
	cDNA Clones for ASPH
	4000+ Proteins
	Search Sino Biological for antibodies, proteins & pathways
	Protein Production Services
	Transfection Reagents
	Protein A/G/L resins
	Isotyping reagents

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	ASPH antibodies
	ASPH proteins
	ASPH lysates

	Antibodies for ASPH
	See all of Abcam's Antibodies, Kits and Proteins for ASPH
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Recombinant Protein for ASPH

	Proteins for ASPH
	Antibodies for ASPH
	ELISAs for ASPH
	CLIAs for ASPH

Browse ESI BIO Cell Lines and PureStem Progenitors for ASPH

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ASPH

	SwitchGear 3'UTR luciferase reporter plasmids for ASPH
	SwitchGear Promoter luciferase reporter plasmids for ASPH

Search ThermoFisher Antibodies for ASPH

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ASPH

	inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ASPH
	inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ASPH

LSBio Antibodies in human, mouse, rat for ASPH

Customized transgenic rodents for:

	Humanization
	Biomarker expression
	Off-target effect monitoring
	Translational medicine
	Tissue-specific gene expresssion
	Time-controlled gene expresssion

Browse compounds at ApexBio

GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

View Random Gene

Category			(GIFtS: )
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes ASPH gene at Home site.

Version: 3.12.136 22 July 2014
hostname: 356977-web1.xennexinc.com index build: 126 solr: 1.4

GeneCards Plus

Advanced Search

Export list of displayed genes

ASPH Gene

Aspartate Beta-Hydroxylase

Aliases
for ASPH gene

Summaries
for ASPH gene

Genomic Views
for ASPH gene

Proteins
for ASPH gene

ASPH Human Recombinant Protein Products:

ASPH Antibody Products:

ASPH Assay Products:

Domains /
Families
for ASPH gene

Function
for ASPH gene

Localization
for ASPH gene

Pathways & Interactions
for ASPH gene

Drugs & Compounds
for ASPH gene

Transcripts
for ASPH gene

Expression
for ASPH gene

Orthologs
for ASPH gene

Paralogs
for ASPH gene

Genomic Variants
for ASPH gene

Disorders / Diseases
for ASPH gene

Publications
for ASPH gene

External Searches for ASPH gene

Genome Databases showing ASPH gene

Other Databases showing ASPH gene

Specialized Databases showing ASPH gene

Intellectual Property
for ASPH gene

Products
for ASPH gene

View Random Gene

GeneCards Plus

Advanced Search

Export list of displayed genes

ASPH Gene

Aspartate Beta-Hydroxylase

Aliasesfor ASPH gene

Summariesfor ASPH gene

Genomic Viewsfor ASPH gene

Proteinsfor ASPH gene

ASPH Human Recombinant Protein Products:

ASPH Antibody Products:

ASPH Assay Products:

Domains /Familiesfor ASPH gene

Functionfor ASPH gene

Localizationfor ASPH gene

Pathways & Interactionsfor ASPH gene

Drugs & Compoundsfor ASPH gene

Transcriptsfor ASPH gene

Expression for ASPH gene

Orthologsfor ASPH gene

Paralogsfor ASPH gene

Genomic Variantsfor ASPH gene

Disorders / Diseasesfor ASPH gene

Publicationsfor ASPH gene

External Searches for ASPH gene

Genome Databases showing ASPH gene

Other Databases showing ASPH gene

Specialized Databases showing ASPH gene

Intellectual Propertyfor ASPH gene

Productsfor ASPH gene

View Random Gene

Aliases
for ASPH gene

Summaries
for ASPH gene

Genomic Views
for ASPH gene

Proteins
for ASPH gene

Domains /
Families
for ASPH gene

Function
for ASPH gene

Localization
for ASPH gene

Pathways & Interactions
for ASPH gene

Drugs & Compounds
for ASPH gene

Transcripts
for ASPH gene

Expression
for ASPH gene

Orthologs
for ASPH gene

Paralogs
for ASPH gene

Genomic Variants
for ASPH gene

Disorders / Diseases
for ASPH gene

Publications
for ASPH gene

Intellectual Property
for ASPH gene

Products
for ASPH gene