Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

AS3MT Gene

protein-coding   GIFtS: 56
GCID: GC10P104629

Arsenic (+3 Oxidation State) Methyltransferase

Alzheimer's & Parkinson's Diseases Congress
  See related disease
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

This gene clusters with an RNA gene
Subcategory (RNA class): lncRNA

Quality score for the ORGUL clustered with this gene is 3

Aliases
Arsenic (+3 Oxidation State) Methyltransferase1 2     Arsenite Methyltransferase2
CYT192 3 5     Methyltransferase Cyt192
Methylarsonite Methyltransferase2 3     S-Adenosylmethionine:Arsenic (III) Methyltransferase2
S-Adenosyl-L-Methionine:Arsenic(III) Methyltransferase2 3     EC 2.1.1.1373

External Ids:    HGNC: 174521   Entrez Gene: 574122   Ensembl: ENSG000002144357   OMIM: 6118065   UniProtKB: Q9HBK93   
ORGUL members:         
NONCODE14:n410502      

Export aliases for AS3MT gene to outside databases

Previous GC identifers: GC10P104294 GC10P104606 GC10P104621 GC10P104603 GC10P104623 GC10P104624 GC10P098263


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for AS3MT Gene:
AS3MT catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (AdoMet) to trivalent arsenical and
may play a role in arsenic metabolism (Lin et al., 2002 (PubMed 11790780)).(supplied by OMIM, Mar 2008)

GeneCards Summary for AS3MT Gene: 
AS3MT (arsenic (+3 oxidation state) methyltransferase) is a protein-coding gene, and is affiliated with the lncRNA class. Diseases associated with AS3MT include alzheimer's disease, and among its related super-pathways are xanthine and xanthosine salvage. GO annotations related to this gene include methylarsonite methyltransferase activity and arsenite methyltransferase activity.

UniProtKB/Swiss-Prot: AS3MT_HUMAN, Q9HBK9
Function: Catalyzes the transfer of a methyl group from AdoMet to trivalent arsenicals producing methylated and
dimethylated arsenicals. It methylates arsenite to form methylarsonate, Me-AsO(3)H(2), which is reduced by
methylarsonate reductase to methylarsonite, Me-As(OH)2. Methylarsonite is also a substrate and it is converted
into the much less toxic compound dimethylarsinate (cacodylate), Me(2)As(O)-OH (By similarity)

Gene Wiki entry for AS3MT Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000010.10  NT_030059.13  NC_018921.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the AS3MT gene promoter:
         E2F-4   E2F-3a   E2F-5   C/EBPbeta   FOXO3   E2F-2   C/EBPalpha   E2F   E2F-1   c-Myb   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidAS3MT promoter sequence
   Search SABiosciences Chromatin IP Primers for AS3MT

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat AS3MT


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 10q24.32   Ensembl cytogenetic band:  10q24.32   HGNC cytogenetic band: 10q24.33

AS3MT Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
AS3MT gene location

GeneLoc information about chromosome 10         GeneLoc Exon Structure

GeneLoc location for GC10P104629:  view genomic region     (about GC identifiers)

Start:
104,629,210 bp from pter      End:
104,661,656 bp from pter
Size:
32,447 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: AS3MT_HUMAN, Q9HBK9 (See protein sequence)
Recommended Name: Arsenite methyltransferase  
Size: 375 amino acids; 41748 Da
Subcellular location: Cytoplasm (By similarity)
Sequence caution: Sequence=AAG09731.1; Type=Frameshift; Positions=333;
Secondary accessions: A6NP79 Q5PZ02

Explore the universe of human proteins at neXtProt for AS3MT: NX_Q9HBK9

Explore proteomics data for AS3MT at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q9HBK9

  • AS3MT Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    AS3MT Protein Expression
    REFSEQ proteins: NP_065733.2  
    ENSEMBL proteins: 
     ENSP00000358896  

    Human Recombinant Protein Products for AS3MT: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for AS3MT
    OriGene Protein Over-expression Lysate for AS3MT
    OriGene MassSpec for AS3MT 
    OriGene Custom Protein Services for AS3MT
    GenScript Custom Purified and Recombinant Proteins Services for AS3MT
    Novus Biologicals AS3MT Protein
    Novus Biologicals AS3MT Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    ProSpec Recombinant Protein for AS3MT
    Cloud-Clone Corp. Proteins for AS3MT 

    Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005739mitochondrion IEA--
    GO:0005829cytosol ISS--

    AS3MT for ontologies           About GeneDecksing



    AS3MT Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of AS3MT
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for AS3MT
    GenScript Custom Superior Antibodies Services for AS3MT
    Novus Biologicals AS3MT Antibodies
    Abcam antibodies for AS3MT
    Cloud-Clone Corp. Antibodies for AS3MT 
    Search ThermoFisher Antibodies for AS3MT
    LSBio Antibodies in human, mouse, rat for AS3MT 

    Assay Products for AS3MT: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for AS3MT
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for AS3MT
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for AS3MT 
    Cloud-Clone Corp. CLIAs for AS3MT


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    2 InterPro protein domains:
     IPR025714 Methyltranfer_dom
     IPR026669 Arsenite_MeTrfase

    Graphical View of Domain Structure for InterPro Entry Q9HBK9

    ProtoNet protein and cluster: Q9HBK9

    1 Blocks protein domain: IPB013216 Methyltransferase type 11

    UniProtKB/Swiss-Prot: AS3MT_HUMAN, Q9HBK9
    Similarity: Belongs to the methyltransferase superfamily


    AS3MT for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: AS3MT_HUMAN, Q9HBK9
    Function: Catalyzes the transfer of a methyl group from AdoMet to trivalent arsenicals producing methylated and
    dimethylated arsenicals. It methylates arsenite to form methylarsonate, Me-AsO(3)H(2), which is reduced by
    methylarsonate reductase to methylarsonite, Me-As(OH)2. Methylarsonite is also a substrate and it is converted
    into the much less toxic compound dimethylarsinate (cacodylate), Me(2)As(O)-OH (By similarity)
    Catalytic activity: S-adenosyl-L-methionine + arsenite = S-adenosyl-L-homocysteine + methylarsonate
    Catalytic activity: S-adenosyl-L-methionine + methylarsonite = S-adenosyl-L-homocysteine + dimethylarsinate
    Biophysicochemical properties: Kinetic parameters: KM=4.6 uM for sodium arsenite; KM=11.8 uM for AdoMet;

         Enzyme Number (IUBMB): EC 2.1.1.1371

         Gene Ontology (GO): 4 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004719protein-L-isoaspartate (D-aspartate) O-methyltransferase activity ----
    GO:0008168methyltransferase activity ----
    GO:0030791arsenite methyltransferase activity ISS--
    GO:0030792methylarsonite methyltransferase activity ISS--
         
    AS3MT for ontologies           About GeneDecksing


    Phenotypes:
         2 MGI mutant phenotypes (inferred from 2 alleles(MGI details for As3mt):
     homeostasis/metabolism  liver/biliary system 

    AS3MT for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out As3mttm1Djth for AS3MT

       inGenious Targeting Laboratory - Custom generated mouse model solutions for AS3MT 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for AS3MT

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for AS3MT 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for AS3MT 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat AS3MT
    7 QIAGEN miScript miRNA Assays for microRNAs that regulate AS3MT:
    hsa-miR-708 hsa-miR-182 hsa-miR-593* hsa-miR-28-5p hsa-miR-1252 hsa-miR-3139 hsa-miR-548c-3p
    SwitchGear 3'UTR luciferase reporter plasmidAS3MT 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for AS3MT
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat AS3MT

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for AS3MT
    Sirion Biotech Customized adenovirus for overexpression of AS3MT

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for AS3MT (see all 7)
    OriGene ORF clones in mouse, rat for AS3MT
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: AS3MT (NM_020682)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for AS3MT
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AS3MT
    Sirion Biotech Customized lentivirus for stable overexpression of AS3MT 
                         Customized lentivirus expression plasmids for stable overexpression of AS3MT 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for AS3MT
    Search LifeMap BioReagents cell lines for AS3MT
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AS3MT


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for AS3MT About                                                                                                See pathways by source

    SuperPathContained pathways About
    1adenine and adenosine salvage III
    arsenate detoxification I (glutaredoxin)0.33


    1 BioSystems Pathway for AS3MT
        arsenate detoxification I (glutaredoxin)


    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for AS3MT

    STRING Interaction Network Preview (showing 1 interactants - click image to see more details)

    1 Interacting protein for AS3MT (ENSP000003588964) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    GSTO1ENSP000003587274STRING: ENSP00000358727
    About this table

    Gene Ontology (GO): 4 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006464cellular protein modification process ----
    GO:0008152metabolic process ----
    GO:0009404toxin metabolic process ISS--
    GO:0018872arsonoacetate metabolic process ISS--

    AS3MT for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    AS3MT for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for AS3MT

    6 HMDB Compounds for AS3MT    About this table
    CompoundSynonyms CAS #PubMed Ids
    ArsenicAs (see all 9)7440-38-2--
    ArseniteAArsenite (AsO33-) (see all 16)15502-74-6--
    Dimethylarsinatedimethylarsinate (see all 17)15132-04-4--
    L-Methionine(2S)-2-amino-4-(methylsulfanyl)butanoic acid (see all 54)63-68-3--
    S-Adenosylhomocysteine(S)-5'-(S)-(3-Amino-3-carboxypropyl)-5'-thioadenosine (see all 19)979-92-0--
    S-Adenosylmethionine(3S)-5'-[(3-amino-3-carboxypropyl)methylsulfonio]-5'-deoxyadenosine (see all 16)29908-03-0--

    4 Novoseek inferred chemical compound relationships for AS3MT gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    arsenicals 87.8 4 19538983 (1), 19691357 (1), 15276411 (1), 15526190 (1)
    arsenite 81.3 19 11684318 (2), 19411561 (2), 16102566 (1), 19932709 (1) (see all 9)
    arsenate 80.6 1 10328340 (1)
    s-adenosylmethionine 64.2 2 19538983 (1), 15526190 (1)

    Search CenterWatch for drugs/clinical trials and news about AS3MT

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for AS3MT gene: 
    NM_020682.3  

    Unigene Cluster for AS3MT:

    Arsenic (+3 oxidation state) methyltransferase
    Hs.720370  [show with all ESTs]
    Unigene Representative Sequence: NR_037644
    1 Ensembl transcript including schematic representation, and UCSC links where relevant:
    ENST00000369880(uc001kwj.3 uc009xxh.3 uc001kwk.3)

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat AS3MT
    7 QIAGEN miScript miRNA Assays for microRNAs that regulate AS3MT:
    hsa-miR-708 hsa-miR-182 hsa-miR-593* hsa-miR-28-5p hsa-miR-1252 hsa-miR-3139 hsa-miR-548c-3p
    SwitchGear 3'UTR luciferase reporter plasmidAS3MT 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for AS3MT
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat AS3MT
    Clone
    Products:
         
    OriGene clones in human, mouse for AS3MT (see all 7)
    OriGene ORF clones in mouse, rat for AS3MT
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: AS3MT (NM_020682)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for AS3MT
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AS3MT
    Sirion Biotech Customized lentivirus for stable overexpression of AS3MT 
                         Customized lentivirus expression plasmids for stable overexpression of AS3MT 
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for AS3MT
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat AS3MT
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat AS3MT
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat AS3MT

    Additional mRNA sequence: 

    AF226730.1 AK057833.1 AK225972.1 AK309737.1 BC119637.1 BC119638.2 NR_037644.1 

    7 DOTS entries:

    DT.95093491  DT.100756763  DT.75102658  DT.95368884  DT.100716538  DT.86854090  DT.121506281 

    24/261 AceView cDNA sequences (see all 261):

    R73891 AW161513 BM887676 CA777536 AI216455 AV650805 AV650273 AV762757 
    AA234980 AI628634 CA312126 AI580507 BU074588 BF056533 BF196047 BQ028789 
    AW301647 W04252 BU189046 AI652047 AA992126 AI868325 CK902920 AI126419 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    AS3MT expression in normal human tissues (normalized intensities)      AS3MT embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TTTGGTAGGA
    AS3MT Expression
    About this image


    AS3MT expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/3 selected tissues (see all 3) fully expand
     
     Liver (Hepatobiliary System)
             Periportal Hepatocytes Liver Lobule
     
     Epiblast (Early Embryonic Tissues)
             Epiblast Stem Cell line 5
     
     Kidney (Urinary System)

    See AS3MT Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for AS3MT

    SOURCE GeneReport for Unigene cluster: Hs.720370
        SABiosciences Expression via Pathway-Focused PCR Array including AS3MT: 
              Drug Metabolism: Phase II Enzymes in human mouse rat

    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for AS3MT
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat AS3MT
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat AS3MT
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat AS3MT
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AS3MT

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for AS3MT gene from 4/12 species (see all 12)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia As3mt1 , 5 arsenic (+3 oxidation state) methyltransferase1, 5 81.24(n)1
    76.8(a)1
      19 (38.97 cM)5
    573441  NM_020577.21  NP_065602.21 
     467074435 
    chicken
    (Gallus gallus)
    Aves AS3MT1 arsenic (+3 oxidation state) methyltransferase 63.28(n)
    62.09(a)
      423870  XM_421735.3  XP_421735.3 
    lizard
    (Anolis carolinensis)
    Reptilia AS3MT6
    arsenic (+3 oxidation state) methyltransferase
    62(a)
    1 ↔ 1
    3(40291565-40326315)
    zebrafish
    (Danio rerio)
    Actinopterygii as3mt1 arsenic (+3 oxidation state) methyltransferase 61.25(n)
    53.44(a)
      664699  NM_001039839.1  NP_001034928.1 


    ENSEMBL Gene Tree for AS3MT (if available)
    TreeFam Gene Tree for AS3MT (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/17 SNPs in AS3MT are shown (see all 17)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 10 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0273924
    ----see VAR_0273922 R W mis40--------
    VAR_0273944
    ----see VAR_0273942 T I mis40--------
    VAR_0273934
    ----see VAR_0273932 M T mis40--------
    rs667919241,2
    C--104629366(-) GCGCC-/CAGGGCGCGCACTCACT
    GTCTCCTCGGCCTGCGACT
    CAGGG
    1 -- cds11Minor allele frequency- CAGGGCGCGCACTCACTGTCTCCTCGGCCTGCGACT:0.00NA 2
    rs38326851,2
    C--104629793(-) AAGAG-/GAGCTGTG 1 -- cds10--------
    rs1397923281,2
    C--104631485(+) GTCTC-/AAAC  
      AAAACA
    AAACA
    1 -- int10--------
    rs178797811,2
    C--104633053(+) TTATTTTT/-GAGAT 1 -- cds11Minor allele frequency- -:0.00NA 2
    rs340062631,2
    C--104639667(+) TATAT-/A/AT  
            
    TTATT
    1 -- int11NA 2
    rs1473552451,2
    C--104646089(+) TTTTT-/TGAGAG 1 -- int10--------
    rs3740240941,2
    C--104648628(+) ATATA-/ATAT  
     ATATATA
    TATAT
    1 -- int10--------

    HapMap Linkage Disequilibrium report for AS3MT (104629210 - 104661656 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 4 variations for AS3MT:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2740239CNV Deletion23290073
    esv1651901CNV Deletion17803354
    esv2740251CNV Deletion23290073
    esv2489056CNV Deletion19546169


    Human Gene Mutation Database (HGMD): AS3MT
    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing AS3MT
    DNA2.0 Custom Variant and Variant Library Synthesis for AS3MT

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 611806    OMIM disorders: --

    2 diseases for AS3MT:    About MalaCards
    alzheimer's disease    


    AS3MT for disorders           About GeneDecksing


    Congresses - knowledge worth sharing:  
    Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015
    Genetic Association Database (GAD): AS3MT
    Human Genome Epidemiology (HuGE) Navigator: AS3MT (23 documents)

    Export disorders for AS3MT gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for AS3MT gene, integrated from 9 sources (see all 67):
    (articles sorted by number of sources associating them with AS3MT)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. High arsenic metabolic efficiency in AS3MT287Thr allele carriers. (PubMed id 18334919)1, 2, 4 Hernandez A....Marcos R. (2008)
    2. Association of AS3MT polymorphisms and the risk of premalignant arsenic skin lesions. (PubMed id 19538983)1, 4, 9 Valenzuela O.L....Del Razo L.M. (2009)
    3. Global analysis of genetic variation in human arsenic (+3 oxidation state) methyltransferase (AS3MT). (PubMed id 19932709)1, 4, 9 Fujihara J....Takeshita H. (2010)
    4. Ethnic differences in five intronic polymorphisms associated with arsenic metabolism within human arsenic (+3 oxidation state) methyltransferase (AS3MT) gene. (PubMed id 18976679)1, 4, 9 Fujihara J....Takeshita H. (2009)
    5. Human arsenic methyltransferase (AS3MT) pharmacogenetics: gene resequencing and functional genomics studies. (PubMed id 16407288)1, 2, 9 Wood T.C....Weinshilboum R.M. (2006)
    6. Population differences in the human arsenic (+3 oxidation state) methyltransferase (AS3MT) gene polymorphism detected by using genotyping method. (PubMed id 17889916)1, 4, 9 Fujihara J....Takeshita H. (2007)
    7. Arsenic metabolism is influenced by polymorphisms in genes involved in one-carbon metabolism and reduction reactions. (PubMed id 18682255)1, 4, 9 Schlawicke Engstrom K....Broberg K. (2008)
    8. Genetic variants associated with arsenic susceptibility: study of purine nucleoside phosphorylase, arsenic (+3) methyltransferase, and glutathione s-transferase omega genes. (PubMed id 18414634)1, 4, 9 De Chaudhuri S....Giri A.K. (2008)
    9. Genetic polymorphisms influencing arsenic metabolism: evidence from Argentina. (PubMed id 17450230)1, 4, 9 Schlawicke Engstrom K....Vahter M. (2007)
    10. Low 8-oxo-7,8-dihydro-2'-deoxyguanosine levels and in fluence of genetic background in an Andean population exposed to high levels of arsenic. (PubMed id 19896490)1, 4, 9 EngstrAPm K.S....Broberg K. (2010)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 57412 HGNC: 17452 AceView: AS3MTandC10orf32 Ensembl:ENSG00000214435 euGenes: HUgn57412
    ECgene: AS3MT H-InvDB: AS3MT

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for AS3MT Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for AS3MT gene:
    Search GeneIP for patents involving AS3MT

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     Browse Small Molecules at EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of AS3MT
     Browse Kits and Assays available from EMD Millipore
     Browse for Gene Knock-down Tools from EMD Millipore
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     Browse Purified and Recombinant Proteins at EMD Millipore
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for AS3MT  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for AS3MT  
     OriGene MassSpec something-or-other for AS3MT   OriGene clones in human, mouse for AS3MT  
     OriGene qSTAR qPCR primer pairs in human, mouse for AS3MT   OriGene Purified Protein for AS3MT  
     OriGene ORF clones in mouse, rat for AS3MT   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for AS3MT   OriGene Custom Protein Services for AS3MT  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat AS3MT
     QIAGEN SeqTarget long-range PCR primers for resequencing AS3MT
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat AS3MT
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat AS3MT
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat AS3MT
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat AS3MT
     GenScript Custom Purified and Recombinant Proteins Services for AS3MT GenScript cDNA clones with any tag delivered in your preferred vector for AS3MT
     GenScript Custom Assay Services for AS3MT GenScript Custom Superior Antibodies Services for AS3MT
     GenScript Custom overexpressing Cell Line Services for AS3MT CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in AS3MT promoter
     Search Chromatin IP Primers for AS3MT
     RT2 qPCR Primer Assay in human, mouse, rat AS3MT
     Search GNC Networks for AS3MT
     SABiosciences PCR Arrays including human, mouse, rat AS3MT
     Search Tocris compounds for AS3MT
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     AS3MT antibodies
     AS3MT proteins
     AS3MT lysates
     Antibodies for AS3MT
     See all of Abcam's Antibodies, Kits and Proteins for AS3MT
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for AS3MT




     Proteins for AS3MT
     Antibodies for AS3MT
     ELISAs for AS3MT
     CLIAs for AS3MT
     Search LifeMap BioReagents cell lines for AS3MT
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AS3MT
     SwitchGear 3'UTR luciferase reporter plasmids for AS3MT
     SwitchGear Promoter luciferase reporter plasmids for AS3MT
     Search ThermoFisher Antibodies for AS3MT
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AS3MT
     inGenious Targeting Laboratory - Custom generated mouse model solutions for AS3MT
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for AS3MT
    Customized:
     lentivirus for stable overexpression of AS3MT
     lentivirus expression plasmids for stable overexpression of AS3MT
     adenovirus for overexpression of AS3MT
     LSBio Antibodies in human, mouse, rat for AS3MT
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 3 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      AS3MT gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4