Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)


AS3MT Gene

protein-coding   GIFtS: 51
GCID: GC10P104629

Arsenic (+3 Oxidation State) Methyltransferase

Alzheimer's & Parkinson's Diseases Congress
  See related diseases

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Arsenic (+3 Oxidation State) Methyltransferase1 2     Arsenite Methyltransferase2
CYT192 3 5     Methyltransferase Cyt192
Methylarsonite Methyltransferase2 3     S-Adenosylmethionine:Arsenic (III) Methyltransferase2
S-Adenosyl-L-Methionine:Arsenic(III) Methyltransferase2 3     EC

External Ids:    HGNC: 174521   Entrez Gene: 574122   Ensembl: ENSG000002144357   OMIM: 6118065   UniProtKB: Q9HBK93   

Export aliases for AS3MT gene to outside databases

Previous GC identifers: GC10P104294 GC10P104606 GC10P104621 GC10P104603 GC10P104623 GC10P104624 GC10P098263

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for AS3MT Gene:
AS3MT catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (AdoMet) to trivalent arsenical and
may play a role in arsenic metabolism (Lin et al., 2002 (PubMed 11790780)).(supplied by OMIM, Mar 2008)

GeneCards Summary for AS3MT Gene:
AS3MT (arsenic (+3 oxidation state) methyltransferase) is a protein-coding gene. Diseases associated with AS3MT include alzheimer's disease, and schizophrenia. GO annotations related to this gene include methylarsonite methyltransferase activity and arsenite methyltransferase activity.

UniProtKB/Swiss-Prot: AS3MT_HUMAN, Q9HBK9
Function: Catalyzes the transfer of a methyl group from AdoMet to trivalent arsenicals producing methylated and
dimethylated arsenicals. It methylates arsenite to form methylarsonate, Me-AsO(3)H(2), which is reduced by
methylarsonate reductase to methylarsonite, Me-As(OH)2. Methylarsonite is also a substrate and it is converted
into the much less toxic compound dimethylarsinate (cacodylate), Me(2)As(O)-OH (By similarity)

Gene Wiki entry for AS3MT Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
Regulatory elements:
   Regulatory transcription factor binding sites in the AS3MT gene promoter:
         E2F-4   E2F-3a   E2F-5   C/EBPbeta   FOXO3   E2F-2   C/EBPalpha   E2F   E2F-1   c-Myb   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidAS3MT promoter sequence
   Search Chromatin IP Primers for AS3MT

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat AS3MT

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 10q24.32   Ensembl cytogenetic band:  10q24.32   HGNC cytogenetic band: 10q24.33

AS3MT Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
AS3MT gene location

GeneLoc information about chromosome 10         GeneLoc Exon Structure

GeneLoc location for GC10P104629:  view genomic region     (about GC identifiers)

104,629,210 bp from pter      End:
104,661,656 bp from pter
32,447 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: AS3MT_HUMAN, Q9HBK9 (See protein sequence)
Recommended Name: Arsenite methyltransferase  
Size: 375 amino acids; 41748 Da
Sequence caution: Sequence=AAG09731.1; Type=Frameshift; Positions=333;
Secondary accessions: A6NP79 Q0VDK3 Q0VDK4 Q5PZ02
Alternative splicing: 2 isoforms:  Q9HBK9-1   Q9HBK9-2   (Devoid of methyltransferase activity)

Explore the universe of human proteins at neXtProt for AS3MT: NX_Q9HBK9

Explore proteomics data for AS3MT at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See AS3MT Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_065733.2  
    ENSEMBL proteins: 

    AS3MT Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for AS3MT
    OriGene Protein Over-expression Lysate for AS3MT
    OriGene MassSpec for AS3MT
    OriGene Custom Protein Services for AS3MT
    GenScript Custom Purified and Recombinant Proteins Services for AS3MT
    Novus Biologicals AS3MT Protein
    Novus Biologicals AS3MT Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    ProSpec Recombinant Protein for AS3MT
    Cloud-Clone Corp. Proteins for AS3MT

    AS3MT Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of AS3MT
    Browse R&D Systems for Antibodies
    OriGene Antibodies for AS3MT
    OriGene Custom Antibody Services for AS3MT
    Novus Biologicals AS3MT Antibodies
    Abcam antibodies for AS3MT
    Cloud-Clone Corp. Antibodies for AS3MT
    Search ThermoFisher Antibodies for AS3MT
    LSBio Antibodies in human, mouse, rat for AS3MT

    AS3MT Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for AS3MT
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for AS3MT
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for AS3MT
    Cloud-Clone Corp. CLIAs for AS3MT

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    2 InterPro protein domains:
     IPR025714 Methyltranfer_dom
     IPR026669 Arsenite_MeTrfase

    Graphical View of Domain Structure for InterPro Entry Q9HBK9

    ProtoNet protein and cluster: Q9HBK9

    1 Blocks protein domain: IPB013216 Methyltransferase type 11

    UniProtKB/Swiss-Prot: AS3MT_HUMAN, Q9HBK9
    Similarity: Belongs to the methyltransferase superfamily

    AS3MT for domains           About GeneDecksing

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: AS3MT_HUMAN, Q9HBK9
    Function: Catalyzes the transfer of a methyl group from AdoMet to trivalent arsenicals producing methylated and
    dimethylated arsenicals. It methylates arsenite to form methylarsonate, Me-AsO(3)H(2), which is reduced by
    methylarsonate reductase to methylarsonite, Me-As(OH)2. Methylarsonite is also a substrate and it is converted
    into the much less toxic compound dimethylarsinate (cacodylate), Me(2)As(O)-OH (By similarity)
    Catalytic activity: S-adenosyl-L-methionine + arsenite = S-adenosyl-L-homocysteine + methylarsonate
    Catalytic activity: S-adenosyl-L-methionine + methylarsonite = S-adenosyl-L-homocysteine + dimethylarsinate
    Biophysicochemical properties: Kinetic parameters: KM=4.6 uM for sodium arsenite; KM=11.8 uM for AdoMet;

         Enzyme Number (IUBMB): EC

         Gene Ontology (GO): 4 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004719protein-L-isoaspartate (D-aspartate) O-methyltransferase activity ----
    GO:0008168methyltransferase activity ----
    GO:0030791arsenite methyltransferase activity ISS--
    GO:0030792methylarsonite methyltransferase activity ISS--
    AS3MT for ontologies           About GeneDecksing

         2 MGI mutant phenotypes (inferred from 2 alleles(MGI details for As3mt):
     homeostasis/metabolism  liver/biliary system 

    AS3MT for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out As3mttm1Djth for AS3MT

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for AS3MT
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for AS3MT

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for AS3MT
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for AS3MT

    Block miRNA regulation of human, mouse, rat AS3MT using miScript Target Protectors
    7 qRT-PCR Assays for microRNAs that regulate AS3MT:
    hsa-miR-708 hsa-miR-182 hsa-miR-593* hsa-miR-28-5p hsa-miR-1252 hsa-miR-3139 hsa-miR-548c-3p
    SwitchGear 3'UTR luciferase reporter plasmidAS3MT 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for AS3MT
    Predesigned siRNA for gene silencing in human, mouse, rat AS3MT

    Gene Editing
    DNA2.0 Custom Protein Engineering Service for AS3MT

    OriGene clones in human, mouse for AS3MT (see all 6)
    OriGene ORF clones in mouse, rat for AS3MT
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: AS3MT (NM_020682)
    Sino Biological Human cDNA Clone for AS3MT
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for AS3MT
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AS3MT

    Cell Line
    GenScript Custom overexpressing Cell Line Services for AS3MT
    Browse ESI BIO Cell Lines and PureStem Progenitors for AS3MT 
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AS3MT

    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    AS3MT_HUMAN, Q9HBK9: Cytoplasm (By similarity)
    Subcellular locations from COMPARTMENTS: 


    Gene Ontology (GO): 2 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005739mitochondrion IEA--
    GO:0005829cytosol ISS--

    AS3MT for ontologies           About GeneDecksing

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for AS3MT About                                                                                                See pathways by source

    SuperPathContained pathways About
    1arsenate detoxification I (glutaredoxin)
    arsenate detoxification I (glutaredoxin)

    1 Downloadable PowerPoint Slide of GeneGlobe Pathway Central Maps for AS3MT
        Aldosterone Signaling in Epithelial Cells

    1 BioSystems Pathway for AS3MT
        arsenate detoxification I (glutaredoxin)

        Pathway & Disease-focused RT2 Profiler PCR Array including AS3MT: 
              Drug Metabolism: Phase II Enzymes in human mouse rat


        Search GeneGlobe Interaction Network for AS3MT

    STRING Interaction Network Preview (showing 1 interactants - click image to see more details)

    1 Interacting protein for AS3MT (ENSP000003588964) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    GSTO1ENSP000003587274STRING: ENSP00000358727
    About this table

    Gene Ontology (GO): 4 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006464cellular protein modification process ----
    GO:0008152metabolic process ----
    GO:0009404toxin metabolic process ISS--
    GO:0018872arsonoacetate metabolic process ISS--

    AS3MT for ontologies           About GeneDecksing

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for AS3MT

    6 HMDB Compounds for AS3MT    About this table
    CompoundSynonyms CAS #PubMed Ids
    ArsenicAs (see all 9)7440-38-2--
    ArseniteAArsenite (AsO33-) (see all 16)15502-74-6--
    Dimethylarsinatedimethylarsinate (see all 17)15132-04-4--
    L-Methionine(2S)-2-amino-4-(methylsulfanyl)butanoic acid (see all 54)63-68-3--
    S-Adenosylhomocysteine(S)-5'-(S)-(3-Amino-3-carboxypropyl)-5'-thioadenosine (see all 19)979-92-0--
    S-Adenosylmethionine(3S)-5'-[(3-amino-3-carboxypropyl)methylsulfonio]-5'-deoxyadenosine (see all 16)29908-03-0--

    4 Novoseek inferred chemical compound relationships for AS3MT gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    arsenicals 87.8 4 19538983 (1), 19691357 (1), 15276411 (1), 15526190 (1)
    arsenite 81.3 19 11684318 (2), 19411561 (2), 16102566 (1), 19932709 (1) (see all 9)
    arsenate 80.6 1 10328340 (1)
    s-adenosylmethionine 64.2 2 19538983 (1), 15526190 (1)

    AS3MT for compounds           About GeneDecksing

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for AS3MT gene: 

    1 Ensembl transcript including schematic representation, and UCSC links where relevant:
    ENST00000369880(uc001kwj.3 uc009xxh.3 uc001kwk.3)

    Block miRNA regulation of human, mouse, rat AS3MT using miScript Target Protectors
    7 qRT-PCR Assays for microRNAs that regulate AS3MT:
    hsa-miR-708 hsa-miR-182 hsa-miR-593* hsa-miR-28-5p hsa-miR-1252 hsa-miR-3139 hsa-miR-548c-3p
    SwitchGear 3'UTR luciferase reporter plasmidAS3MT 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for AS3MT
    Predesigned siRNA for gene silencing in human, mouse, rat AS3MT
    OriGene clones in human, mouse for AS3MT (see all 6)
    OriGene ORF clones in mouse, rat for AS3MT
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: AS3MT (NM_020682)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for AS3MT
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AS3MT
    OriGene qSTAR qPCR primer pairs in human, mouse for AS3MT
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat AS3MT
      QuantiTect SYBR Green Assays in human, mouse, rat AS3MT
      QuantiFast Probe-based Assays in human, mouse, rat AS3MT

    Selected AceView cDNA sequences (see all 261):

    BU189046 CA952522 BU074588 CA777536 AI868325 W04252 AA234980 AI628634 
    AI652047 AW161513 CA444341 BX279728 BF196047 BQ028789 AK098071 BQ186811 
    BF056533 AI216455 AW301647 AV650273 AA976545 AI675080 AI126419 AI580507 

    GeneLoc Exon Structure

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    AS3MT expression in normal human tissues (normalized intensities)      AS3MT embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    AS3MT Expression
    About this image

    AS3MT expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 3) fully expand
     Liver (Hepatobiliary System)
             Periportal Hepatocytes Liver Lobule
     Epiblast (Early Embryonic Tissues)
             Epiblast Stem Cell line 5
     Kidney (Urinary System)
    AS3MT Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    AS3MT Protein Expression
        Pathway & Disease-focused RT2 Profiler PCR Array including AS3MT: 
              Drug Metabolism: Phase II Enzymes in human mouse rat

    OriGene qSTAR qPCR primer pairs in human, mouse for AS3MT
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat AS3MT
    QuantiTect SYBR Green Assays in human, mouse, rat AS3MT
    QuantiFast Probe-based Assays in human, mouse, rat AS3MT
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AS3MT

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of chordates.

    Orthologs for AS3MT gene from Selected species (see all 13)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia As3mt1 , 5 arsenic (+3 oxidation state) methyltransferase1, 5 81.24(n)1
      19 (38.97 cM)5
    573441  NM_020577.21  NP_065602.21 
    (Gallus gallus)
    Aves AS3MT1 arsenic (+3 oxidation state) methyltransferase 63.28(n)
      423870  XM_421735.4  XP_421735.3 
    (Anolis carolinensis)
    Reptilia AS3MT6
    arsenic (+3 oxidation state) methyltransferase
    1 ↔ 1
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia as3mt1 arsenic (+3 oxidation state) methyltransferase 64.72(n)
      100216291  NM_001142242.1  NP_001135714.1 
    (Danio rerio)
    Actinopterygii as3mt1 arsenic (+3 oxidation state) methyltransferase 60.98(n)
      664699  NM_001039839.1  NP_001034928.1 

    ENSEMBL Gene Tree for AS3MT (if available)
    TreeFam Gene Tree for AS3MT (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68)
    About This Section

    TryGeneCards Plus

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for AS3MT (see all 17)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 10 posSequence#AA
    1 -- cds11Minor allele frequency- CAGGGCGCGCACTCACTGTCTCCTCGGCCTGCGACT:0.00NA 2
    C--104629793(-) AAGAG-/GAGCTGTG 1 -- cds10--------
    C--104631485(+) GTCTC-/AAAC  
    1 -- int10--------
    C--104633053(+) TTATTTTT/-GAGAT 1 -- cds11Minor allele frequency- -:0.00NA 2
    C--104639667(+) TATAT-/A/AT  
    1 -- int11NA 2
    C--104646089(+) TTTTT-/TGAGAG 1 -- int10--------
    C--104648628(+) ATATA-/ATAT  
    1 -- int10--------
    C--104652815(+) AAAAAA/-CTGTA 1 -- int11Minor allele frequency- -:0.00NA 2
    ----see VAR_0273922 mis40--------
    ----see VAR_0273942 mis40--------

    HapMap Linkage Disequilibrium report for AS3MT (104629210 - 104661656 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 4 variations for AS3MT:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2740239CNV Deletion23290073
    esv1651901CNV Deletion17803354
    esv2740251CNV Deletion23290073
    esv2489056CNV Deletion19546169

    Human Gene Mutation Database (HGMD): AS3MT
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing AS3MT
    DNA2.0 Custom Variant and Variant Library Synthesis for AS3MT

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 611806    OMIM disorders: --

    4 diseases for AS3MT:    About MalaCards
    alzheimer's disease    schizophrenia    prostate cancer    prostatitis

    AS3MT for disorders           About GeneDecksing

    Congresses - knowledge worth sharing:
    Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015
    Genetic Association Database (GAD): AS3MT
    Human Genome Epidemiology (HuGE) Navigator: AS3MT (23 documents)

    Export disorders for AS3MT gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for AS3MT gene, integrated from 10 sources (see all 71):
    (articles sorted by number of sources associating them with AS3MT)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. High arsenic metabolic efficiency in AS3MT287Thr allele carriers. (PubMed id 18334919)1, 2, 4 Hernandez A.... Marcos R. (Pharmacogenet. Genomics 2008)
    2. Association of AS3MT polymorphisms and the risk of premalignant arsenic skin lesions. (PubMed id 19538983)1, 4, 9 Valenzuela O.L....Del Razo L.M. (Toxicol. Appl. Pharmacol. 2009)
    3. Global analysis of genetic variation in human arsenic (+3 oxidation state) methyltransferase (AS3MT). (PubMed id 19932709)1, 4, 9 Fujihara J....Takeshita H. (Toxicol. Appl. Pharmacol. 2010)
    4. Ethnic differences in five intronic polymorphisms associated with arsenic metabolism within human arsenic (+3 oxidation state) methyltransferase (AS3MT) gene. (PubMed id 18976679)1, 4, 9 Fujihara J....Takeshita H. (Toxicol. Appl. Pharmacol. 2009)
    5. Human arsenic methyltransferase (AS3MT) pharmacogenetics: gene resequencing and functional genomics studies. (PubMed id 16407288)1, 2, 9 Wood T.C....Weinshilboum R.M. (J. Biol. Chem. 2006)
    6. Population differences in the human arsenic (+3 oxidation state) methyltransferase (AS3MT) gene polymorphism detected by using genotyping method. (PubMed id 17889916)1, 4, 9 Fujihara J....Takeshita H. (Toxicol. Appl. Pharmacol. 2007)
    7. Arsenic metabolism is influenced by polymorphisms in genes involved in one-carbon metabolism and reduction reactions. (PubMed id 18682255)1, 4, 9 SchlAowicke EngstrAPm K....Broberg K. (Mutat. Res. 2009)
    8. Genetic variants associated with arsenic susceptibility: study of purine nucleoside phosphorylase, arsenic (+3) methyltransferase, and glutathione S-transferase omega genes. (PubMed id 18414634)1, 4, 9 De Chaudhuri S....Giri A.K. (Environ. Health Perspect. 2008)
    9. Genetic polymorphisms influencing arsenic metabolism: evidence from Argentina. (PubMed id 17450230)1, 4, 9 SchlAowicke EngstrAPm K....Vahter M. (Environ. Health Perspect. 2007)
    10. Low 8-oxo-7,8-dihydro-2'-deoxyguanosine levels and influence of genetic background in an Andean population exposed to high levels of arsenic. (PubMed id 19896490)1, 4, 9 EngstrAPm K.S....Broberg K. (Mutat. Res. 2010)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 57412 HGNC: 17452 AceView: AS3MTandC10orf32 Ensembl:ENSG00000214435 euGenes: HUgn57412
    ECgene: AS3MT H-InvDB: AS3MT

    (According to HUGE)
    About This Section

    TryGeneCards Plus

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    PharmGKB entry for AS3MT Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for AS3MT gene:
    Search GeneIP for patents involving AS3MT

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     Browse Small Molecules at EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of AS3MT
     EMD Millipore genomic analysis products

     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for AS3MT   OriGene RNAi products in human, mouse, rat for AS3MT  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for AS3MT  
     OriGene MassSpec something-or-other for AS3MT   OriGene clones in human, mouse for AS3MT  
     OriGene qSTAR qPCR primer pairs in human, mouse for AS3MT   OriGene Purified Protein for AS3MT  
     OriGene ORF clones in mouse, rat for AS3MT   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for AS3MT   OriGene Custom Protein Services for AS3MT  

     Block miRNA regulation of human, mouse, rat AS3MT using miScript Target Protectors SeqTarget long-range PCR primers for resequencing AS3MT
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat AS3MT Predesigned siRNA for gene silencing in human, mouse, rat AS3MT
     QuantiFast Probe-based Assays in human, mouse, rat AS3MT QuantiTect SYBR Green Assays in human, mouse, rat AS3MT
     PCR Arrays including human, mouse, rat AS3MT Search Chromatin IP Primers for AS3MT
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat AS3MT  Search GeneGlobe Interaction Network for AS3MT
     Regulatory tfbs in AS3MT promoter
     GenScript Custom Purified and Recombinant Proteins Services for AS3MT GenScript cDNA clones with any tag delivered in your preferred vector for AS3MT
     GenScript Custom Assay Services for AS3MT GenScript Custom overexpressing Cell Line Services for AS3MT
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for AS3MT
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for AS3MT
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     AS3MT antibodies
     AS3MT proteins
     AS3MT lysates
     Antibodies for AS3MT
     See all of Abcam's Antibodies, Kits and Proteins for AS3MT
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for AS3MT
     Proteins for AS3MT
     Antibodies for AS3MT
     ELISAs for AS3MT
     CLIAs for AS3MT

     Browse ESI BIO Cell Lines and PureStem Progenitors for AS3MT
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AS3MT
     SwitchGear 3'UTR luciferase reporter plasmids for AS3MT
     SwitchGear Promoter luciferase reporter plasmids for AS3MT
     Search ThermoFisher Antibodies for AS3MT
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AS3MT
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for AS3MT
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for AS3MT
     LSBio Antibodies in human, mouse, rat for AS3MT
    Customized transgenic rodents for:
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      AS3MT gene at Home site.
    Version: 3.12.136 22 July 2014
    hostname: index build: 126 solr: 1.4