Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ARID1A Gene

Aliases for ARID1A Gene

  • AT-Rich Interaction Domain 1A 2 3 5
  • SWI/SNF-Related, Matrix-Associated, Actin-Dependent Regulator Of Chromatin Subfamily F Member 1 3 4
  • AT Rich Interactive Domain 1A (SWI-Like) 2 3
  • ARID Domain-Containing Protein 1A 3 4
  • SWI/SNF Complex Protein P270 3 4
  • BRG1-Associated Factor 250a 3 4
  • SWI-Like Protein 3 4
  • Osa Homolog 1 3 4
  • BAF250a 3 4
  • SMARCF1 3 4
  • C1orf4 3 4
  • BAF250 3 4
  • HOSA1 3 4
  • B120 3 4
  • OSA1 3 4
  • HELD 3 4
  • SWI/SNF Related, Matrix Associated, Actin Dependent Regulator Of Chromatin, Subfamily F, Member 1 2
  • AT-Rich Interactive Domain-Containing Protein 1A 3
  • AT Rich Interactive Domain 1A (SWI- Like) 2
  • Chromatin Remodeling Factor P250 3
  • BRG1-Associated Factor 250 4
  • OSA1 Nuclear Protein 3
  • Brain Protein 120 3
  • BM029 3
  • MRD14 3
  • CSS2 3
  • P270 3
  • ELD 3

External Ids for ARID1A Gene

Previous HGNC Symbols for ARID1A Gene

  • C1orf4

Previous GeneCards Identifiers for ARID1A Gene

  • GC01P026627
  • GC01P026895
  • GC01P027022
  • GC01P025309

Summaries for ARID1A Gene

Entrez Gene Summary for ARID1A Gene

  • This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

CIViC summary for ARID1A Gene

GeneCards Summary for ARID1A Gene

ARID1A (AT-Rich Interaction Domain 1A) is a Protein Coding gene. Diseases associated with ARID1A include Mental Retardation, Autosomal Dominant 14 and Coffin-Siris Syndrome. Among its related pathways are PEDF Induced Signaling and Transcription Ligand-dependent activation of the ESR1/SP pathway. GO annotations related to this gene include binding and ligand-dependent nuclear receptor binding. An important paralog of this gene is ARID1B.

UniProtKB/Swiss-Prot for ARID1A Gene

  • Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Binds DNA non-specifically. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity).

Gene Wiki entry for ARID1A Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ARID1A Gene

Genomics for ARID1A Gene

Regulatory Elements for ARID1A Gene

Enhancers for ARID1A Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01G026618 2.1 FANTOM5 Ensembl ENCODE dbSUPER 15.1 -72.8 -72841 4.0 CREB3L1 AGO1 FEZF1 DMAP1 YY1 ZNF416 ZNF143 ZNF548 ZNF263 SP3 HMGN2 ACTG1P20 ZNF593 AHDC1 LOC101928324 WASF2 NPM1P39 RPL17P9 ARID1A PIGV
GH01G026712 1.1 dbSUPER 16.5 +22.6 22581 8.3 HDGF PKNOX1 FOXA2 ARNT ZNF2 YY1 ZNF143 FOS DEK ZNF263 PIGV ARID1A NUDC ZNF593 ENSG00000243659 SFN ENSG00000226698 RPS6KA1 HMGN2 GPATCH3
GH01G026824 1.8 FANTOM5 ENCODE dbSUPER 9.1 +134.1 134118 6.5 CREB3L1 AGO1 DMAP1 FEZF1 YY1 SLC30A9 ZNF143 ZNF548 ZNF263 SP3 ZDHHC18 ACTG1P20 HMGN2 ENSG00000231344 GPATCH3 NPM1P39 LOC101928324 ZNF593 SFN ENSG00000243659
GH01G026691 3.2 FANTOM5 Ensembl ENCODE dbSUPER 4.9 +3.8 3822 12.9 MLX CREB3L1 AGO1 ZFP64 DMAP1 FEZF1 YY1 SLC30A9 ZNF143 ZNF263 HMGN2 NPM1P39 PIGV ACTG1P20 GPATCH3 ZNF593 LOC101928728 SFN ENSG00000226698 FAM46B
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around ARID1A on UCSC Golden Path with GeneCards custom track

Genomic Location for ARID1A Gene

26,693,236 bp from pter
26,782,110 bp from pter
88,875 bases
Plus strand

Genomic View for ARID1A Gene

Genes around ARID1A on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ARID1A Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ARID1A Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ARID1A Gene

Proteins for ARID1A Gene

  • Protein details for ARID1A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    AT-rich interactive domain-containing protein 1A
    Protein Accession:
    Secondary Accessions:
    • D3DPL1
    • Q53FK9
    • Q5T0W1
    • Q5T0W2
    • Q5T0W3
    • Q8NFD6
    • Q96T89
    • Q9BY33
    • Q9HBJ5
    • Q9UPZ1

    Protein attributes for ARID1A Gene

    2285 amino acids
    Molecular mass:
    242045 Da
    Quaternary structure:
    • Component of SWI/SNF chromatin remodeling complexes, in some of which it can be mutually exclusive with ARID1B/BAF250B. Component of the BAF (SWI/SNF-A) complex, which includes at least actin (ACTB), ARID1A, ARID1B/BAF250, SMARCA2, SMARCA4/BRG1/BAF190A, ACTL6A/BAF53, ACTL6B/BAF53B, SMARCE1/BAF57, SMARCC1/BAF155, SMARCC2/BAF170, SMARCB1/SNF5/INI1, and one or more of SMARCD1/BAF60A, SMARCD2/BAF60B, or SMARCD3/BAF60C. In muscle cells, the BAF complex also contains DPF3. Component of the SWI/SNF-B (PBAF) complex, at least composed of SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, ACTL6A/BAF53A or ACTL6B/BAF53B, SMARCE1/BAF57, SMARCD1/BAF60A, SMARCD2/BAF60B, perhaps SMARCD3/BAF60C, SMARCC1/BAF155, SMARCC2/BAF170, PB1/BAF180, ARID2/BAF200, ARID1A/BAF250A or ARID1B/BAF250B and actin. Component of the SWI/SNF Brm complex, at least composed of SMARCA2/BRM/BAF190B, SMARCB1/BAF47, ACTL6A/BAF53A or ACTL6B/BAF53B, SMARCE1/BAF57, BAF60 (one or more of SMARCD1/BAF60A, SMARCD2/BAF60B, or SMARCD3/BAF60C), SMARCC1/BAF155, SMARCC2/BAF170, ARID1A/BAF250A, SIN3A, HDAC1, HDAC2, and RBAP4. Component of the SWI/SNF complex Brg1(I), at least composed of SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, ACTL6A/BAF53A or ACTL6B/BAF53B, SMARCE1/BAF57, BAF60 (one or more of SMARCD1/BAF60A, SMARCD2/BAF60B, or SMARCD3/BAF60C), SMARCC1/BAF155, SMARCC2/BAF170, ARID1A/BAF250A, SIN3A, and probably HDAC2 and RBAP4. Component of the SWI/SNF Brg1(II), at least composed of SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, ACTL6A/BAF53A or ACTL6B/BAF53B, SMARCE1/BAF57, SMARCC1/BAF155, SMARCC2/BAF170, ARID1A/BAF250A and probably HDAC2 and RBAP4. Component of a SWI/SNF-like EPAFa complex, at least composed of SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, ACTL6A/BAF53A, SMARCE1/BAF57, SMARCD1/BAF60A, SMARCC1/BAF155, SMARCC2/BAF170, BAF250A and MLLT1/ENL. Component of a SWI/SNF-like complex containing ARID1A/BAF250A and ARID1B/BAF250B. Interacts through its C-terminus with SMARCA2/BRM/BAF190B and SMARCA4/BRG1/BAF190A. Interacts with SMARCC1/BAF155. Component of neural progenitors-specific chromatin remodeling complex (npBAF complex) composed of at least, ARID1A/BAF250A or ARID1B/BAF250B, SMARCD1/BAF60A, SMARCD3/BAF60C, SMARCA2/BRM/BAF190B, SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, SMARCC1/BAF155, SMARCE1/BAF57, SMARCC2/BAF170, PHF10/BAF45A, ACTL6A/BAF53A and actin. Component of neuron-specific chromatin remodeling complex (nBAF complex) composed of at least, ARID1A/BAF250A or ARID1B/BAF250B, SMARCD1/BAF60A, SMARCD3/BAF60C, SMARCA2/BRM/BAF190B, SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, SMARCC1/BAF155, SMARCE1/BAF57, SMARCC2/BAF170, DPF1/BAF45B, DPF3/BAF45C, ACTL6B/BAF53B and actin (By similarity).
    • Sequence=AAF75765.1; Type=Frameshift; Positions=374; Evidence={ECO:0000305}; Sequence=AAG33967.1; Type=Frameshift; Positions=872, 885; Evidence={ECO:0000305}; Sequence=BAA23269.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305}; Sequence=BAA83073.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=BAA83073.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for ARID1A Gene

    Alternative splice isoforms for ARID1A Gene


neXtProt entry for ARID1A Gene

Post-translational modifications for ARID1A Gene

  • Ubiquitination at posLast=12011201 and Lys1662
  • Modification sites at PhosphoSitePlus

Antibody Products

  • Cell Signaling Technology (CST) Antibodies for ARID1A (ARID1A)

No data available for DME Specific Peptides for ARID1A Gene

Domains & Families for ARID1A Gene

Gene Families for ARID1A Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ARID1A: view

No data available for UniProtKB/Swiss-Prot for ARID1A Gene

Function for ARID1A Gene

Molecular function for ARID1A Gene

UniProtKB/Swiss-Prot Function:
Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Binds DNA non-specifically. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity).

Gene Ontology (GO) - Molecular Function for ARID1A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding IEA,NAS 10757798
GO:0003713 transcription coactivator activity NAS 8804307
GO:0005515 protein binding IPI 11780067
GO:0016922 ligand-dependent nuclear receptor binding IPI 17363140
GO:0031491 nucleosome binding IEA --
genes like me logo Genes that share ontologies with ARID1A: view
genes like me logo Genes that share phenotypes with ARID1A: view

Human Phenotype Ontology for ARID1A Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for ARID1A Gene

MGI Knock Outs for ARID1A:

Animal Model Products

CRISPR Products

miRNA for ARID1A Gene

miRTarBase miRNAs that target ARID1A

Inhibitory RNA Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for ARID1A Gene

Localization for ARID1A Gene

Subcellular locations from UniProtKB/Swiss-Prot for ARID1A Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ARID1A gene
Compartment Confidence
nucleus 5
cytosol 2
plasma membrane 1
extracellular 1
peroxisome 1
endoplasmic reticulum 1

Gene Ontology (GO) - Cellular Components for ARID1A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000790 nuclear chromatin IDA 17363140
GO:0005634 nucleus TAS 12200431
GO:0005654 nucleoplasm IDA --
GO:0016514 SWI/SNF complex IDA 8804307
GO:0071564 npBAF complex ISS --
genes like me logo Genes that share ontologies with ARID1A: view

Pathways & Interactions for ARID1A Gene

genes like me logo Genes that share pathways with ARID1A: view

Pathways by source for ARID1A Gene

Gene Ontology (GO) - Biological Process for ARID1A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IEA --
GO:0001704 formation of primary germ layer IEA --
GO:0001843 neural tube closure IEA --
GO:0003205 cardiac chamber development IEA --
GO:0003408 optic cup formation involved in camera-type eye development IEA --
genes like me logo Genes that share ontologies with ARID1A: view

No data available for SIGNOR curated interactions for ARID1A Gene

Transcripts for ARID1A Gene

Unigene Clusters for ARID1A Gene

AT rich interactive domain 1A (SWI-like):
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for ARID1A Gene

ExUns: 1 ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6a · 6b ^ 7 ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14a · 14b ^ 15a · 15b · 15c ^ 16 ^ 17a · 17b ^ 18 ^ 19a ·
SP11: -

ExUns: 19b · 19c · 19d ^ 20 ^ 21 ^ 22a · 22b ^ 23 ^ 24
SP9: - -

Relevant External Links for ARID1A Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for ARID1A Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ARID1A Gene

Protein differential expression in normal tissues from HIPED for ARID1A Gene

This gene is overexpressed in Peripheral blood mononuclear cells (12.9), CD8 Tcells (10.6), and Monocytes (6.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for ARID1A Gene

Protein tissue co-expression partners for ARID1A Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of ARID1A Gene:


SOURCE GeneReport for Unigene cluster for ARID1A Gene:


mRNA Expression by UniProt/SwissProt for ARID1A Gene:

Tissue specificity: Highly expressed in spleen, thymus, prostate, testis, ovary, small intestine, colon, and PBL, and at a much lower level in heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas.

Evidence on tissue expression from TISSUES for ARID1A Gene

  • Nervous system(4.8)
  • Liver(4.4)
  • Stomach(4.4)
  • Intestine(3)
  • Muscle(2.3)
  • Blood(2.2)
  • Heart(2.1)
  • Lung(2.1)
  • Lymph node(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ARID1A Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Head and neck:
  • brain
  • cerebellum
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • nose
  • outer ear
  • pharynx
  • scalp
  • skull
  • tooth
  • chest wall
  • clavicle
  • diaphragm
  • esophagus
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
  • abdominal wall
  • biliary tract
  • duodenum
  • intestine
  • kidney
  • large intestine
  • liver
  • pancreas
  • small intestine
  • stomach
  • pelvis
  • penis
  • rectum
  • testicle
  • ureter
  • urethra
  • uterus
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • nail
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
  • blood
  • blood vessel
  • hair
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with ARID1A: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for ARID1A Gene

Orthologs for ARID1A Gene

This gene was present in the common ancestor of animals.

Orthologs for ARID1A Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia ARID1A 34 35
  • 99.74 (n)
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 96 (a)
-- 35
  • 89 (a)
-- 35
  • 75 (a)
-- 35
  • 65 (a)
(Canis familiaris)
Mammalia ARID1A 34 35
  • 95.22 (n)
(Bos Taurus)
Mammalia ARID1A 34 35
  • 94.02 (n)
(Mus musculus)
Mammalia Arid1a 34 16 35
  • 92.07 (n)
(Monodelphis domestica)
Mammalia ARID1A 35
  • 92 (a)
(Rattus norvegicus)
Mammalia Arid1a 34
  • 91.94 (n)
(Gallus gallus)
Aves -- 35
  • 83 (a)
  • 80.54 (n)
-- 35
  • 48 (a)
(Anolis carolinensis)
Reptilia ARID1A 35
  • 85 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia arid1a 34
  • 70.83 (n)
(Danio rerio)
Actinopterygii arid1ab 34 35
  • 69.09 (n)
arid1aa 35
  • 61 (a)
Dr.26931 34
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.12620 34
fruit fly
(Drosophila melanogaster)
Insecta osa 35
  • 25 (a)
(Caenorhabditis elegans)
Secernentea let-526 35
  • 22 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.335 35
  • 47 (a)
Species where no ortholog for ARID1A was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for ARID1A Gene

Gene Tree for ARID1A (if available)
Gene Tree for ARID1A (if available)

Paralogs for ARID1A Gene

Paralogs for ARID1A Gene

(2) SIMAP similar genes for ARID1A Gene using alignment to 8 proteins:

genes like me logo Genes that share paralogs with ARID1A: view

Variants for ARID1A Gene

Sequence variations from dbSNP and Humsavar for ARID1A Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs387906845 Pathogenic 26,766,246(+) TGAAT(C/T)AAGGG reference, stop-gained
rs387906846 Pathogenic 26,773,716(+) AGCAA(C/G/T)GGTGA reference, missense, stop-gained
rs797045262 Pathogenic 26,696,434(+) CCGCC(-/AGCAGCCTGGGCAACCCGCCGCCGCC)GCCGC reference, frameshift-variant
rs797045263 Pathogenic 26,696,797(+) ATGGG(-/G)TGGGG reference, frameshift-variant
rs875989848 Pathogenic 26,697,516(+) GGGGG(-/G)CAGCC reference, frameshift-variant

Structural Variations from Database of Genomic Variants (DGV) for ARID1A Gene

Variant ID Type Subtype PubMed ID
dgv67n106 CNV deletion 24896259
esv275548 CNV loss 21479260
nsv1000012 CNV gain 25217958
nsv1075762 CNV deletion 25765185
nsv1133826 CNV deletion 24896259
nsv7523 CNV deletion 18451855
nsv950340 CNV deletion 24416366
nsv950341 CNV duplication 24416366

Variation tolerance for ARID1A Gene

Residual Variation Intolerance Score: 0.602% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.24; 62.36% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for ARID1A Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ARID1A Gene

Disorders for ARID1A Gene

MalaCards: The human disease database

(16) MalaCards diseases for ARID1A Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
mental retardation, autosomal dominant 14
  • coffin-siris syndrome 2
coffin-siris syndrome
  • dwarfism-onychodysplasia
arid1a-related coffin-siris syndrome
  • mental retardation, autosomal dominant 14
ovarian clear cell carcinoma
  • clear-cell ovarian carcinoma
ovarian clear cell adenocarcinoma
- elite association - COSMIC cancer census association via MalaCards


  • Coffin-Siris syndrome 2 (CSS2) [MIM:614607]: A form of Coffin-Siris syndrome, a congenital multiple malformation syndrome with broad phenotypic and genetic variability. Cardinal features are intellectual disability, coarse facial features, hypertrichosis, and hypoplastic or absent fifth digit nails or phalanges. Additional features include malformations of the cardiac, gastrointestinal, genitourinary, and/or central nervous systems. Sucking/feeding difficulties, poor growth, ophthalmologic abnormalities, hearing impairment, and spinal anomalies are common findings. Both autosomal dominant and autosomal recessive inheritance patterns have been reported. {ECO:0000269 PubMed:22426308}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for ARID1A

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with ARID1A: view

No data available for Genatlas for ARID1A Gene

Publications for ARID1A Gene

  1. Characterization of mammalian orthologues of the Drosophila osa gene: cDNA cloning, expression, chromosomal localization, and direct physical interaction with Brahma chromatin-remodeling complex. (PMID: 11318604) Kozmik Z. … Vlcek C. (Genomics 2001) 3 4 22 64
  2. The human SWI-SNF complex protein p270 is an ARID family member with non-sequence-specific DNA binding activity. (PMID: 10757798) Dallas P.B. … Moran E. (Mol. Cell. Biol. 2000) 3 4 22 64
  3. Molecular cloning and expression of a novel human cDNA containing CAG repeats. (PMID: 9434167) Takeuchi T. … Ohtsuki Y. (Gene 1997) 2 3 4 64
  4. Identification and functional characterization of a novel bipartite nuclear localization sequence in ARID1A. (PMID: 26614907) Bateman N.W. … Conrads T.P. (Biochem. Biophys. Res. Commun. 2016) 3 4 64
  5. Somatic mutations in the chromatin remodeling gene ARID1A occur in several tumor types. (PMID: 22009941) Jones S. … Papadopoulos N. (Hum. Mutat. 2012) 3 4 64

Products for ARID1A Gene

Sources for ARID1A Gene

Loading form....