Aliases for ARID1A Gene
Aliases for ARID1A Gene
- AT-Rich Interaction Domain 1A 2 3 5
- SWI/SNF-Related, Matrix-Associated, Actin-Dependent Regulator Of Chromatin Subfamily F Member 1 3 4
- AT Rich Interactive Domain 1A (SWI-Like) 2 3
- ARID Domain-Containing Protein 1A 3 4
- SWI/SNF Complex Protein P270 3 4
- BRG1-Associated Factor 250a 3 4
- SWI-Like Protein 3 4
- Osa Homolog 1 3 4
- BAF250a 3 4
- SMARCF1 3 4
- C1orf4 3 4
- BAF250 3 4
- HOSA1 3 4
- B120 3 4
- OSA1 3 4
- HELD 3 4
- SWI/SNF Related, Matrix Associated, Actin Dependent Regulator Of Chromatin, Subfamily F, Member 1 2
- AT-Rich Interactive Domain-Containing Protein 1A 3
- AT Rich Interactive Domain 1A (SWI- Like) 2
- Chromatin Remodeling Factor P250 3
- BRG1-Associated Factor 250 4
- OSA1 Nuclear Protein 3
- Brain Protein 120 3
- BM029 3
- MRD14 3
- CSS2 3
- P270 3
- ELD 3
External Ids for ARID1A Gene
- HGNC: 11110
- Entrez Gene: 8289
- Ensembl: ENSG00000117713
- OMIM: 603024
- UniProtKB: O14497
Previous HGNC Symbols for ARID1A Gene
- C1orf4
- SMARCF1
Previous GeneCards Identifiers for ARID1A Gene
- GC01P026627
- GC01P026895
- GC01P027022
- GC01P025309
Summaries for ARID1A Gene
-
This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
GeneCards Summary for ARID1A Gene
ARID1A (AT-Rich Interaction Domain 1A) is a Protein Coding gene. Diseases associated with ARID1A include Mental Retardation, Autosomal Dominant 14 and Coffin-Siris Syndrome. Among its related pathways are PEDF Induced Signaling and Transcription Ligand-dependent activation of the ESR1/SP pathway. GO annotations related to this gene include binding and ligand-dependent nuclear receptor binding. An important paralog of this gene is ARID1B.
UniProtKB/Swiss-Prot for ARID1A Gene
-
Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Binds DNA non-specifically. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity).
No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ARID1A Gene
Genomics for ARID1A Gene
Regulatory Elements for ARID1A Gene
Enhancers for ARID1A Gene
- Elite enhancer and/or Elite enhancer-gene association
Download GeneHancer data dump
Enhancers around ARID1A on UCSC Golden Path with GeneCards custom track
Regulatory Element Products
Genomic Location for ARID1A Gene
- Chromosome:
- 1
- Start:
- 26,693,236 bp from pter
- End:
- 26,782,110 bp from pter
- Size:
- 88,875 bases
- Orientation:
- Plus strand
Genomic View for ARID1A Gene
Genes around ARID1A on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 1p36.11 by Ensembl
- 1p36.11 by Entrez Gene
- 1p36.11 by HGNC
ARID1A Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for ARID1A Gene
Proteins for ARID1A Gene
-
Protein details for ARID1A Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- O14497-ARI1A_HUMAN
- Recommended name:
- AT-rich interactive domain-containing protein 1A
- Protein Accession:
- O14497
- D3DPL1
- Q53FK9
- Q5T0W1
- Q5T0W2
- Q5T0W3
- Q8NFD6
- Q96T89
- Q9BY33
- Q9HBJ5
- Q9UPZ1
Protein attributes for ARID1A Gene
- Size:
- 2285 amino acids
- Molecular mass:
- 242045 Da
- Quaternary structure:
-
- Component of SWI/SNF chromatin remodeling complexes, in some of which it can be mutually exclusive with ARID1B/BAF250B. Component of the BAF (SWI/SNF-A) complex, which includes at least actin (ACTB), ARID1A, ARID1B/BAF250, SMARCA2, SMARCA4/BRG1/BAF190A, ACTL6A/BAF53, ACTL6B/BAF53B, SMARCE1/BAF57, SMARCC1/BAF155, SMARCC2/BAF170, SMARCB1/SNF5/INI1, and one or more of SMARCD1/BAF60A, SMARCD2/BAF60B, or SMARCD3/BAF60C. In muscle cells, the BAF complex also contains DPF3. Component of the SWI/SNF-B (PBAF) complex, at least composed of SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, ACTL6A/BAF53A or ACTL6B/BAF53B, SMARCE1/BAF57, SMARCD1/BAF60A, SMARCD2/BAF60B, perhaps SMARCD3/BAF60C, SMARCC1/BAF155, SMARCC2/BAF170, PB1/BAF180, ARID2/BAF200, ARID1A/BAF250A or ARID1B/BAF250B and actin. Component of the SWI/SNF Brm complex, at least composed of SMARCA2/BRM/BAF190B, SMARCB1/BAF47, ACTL6A/BAF53A or ACTL6B/BAF53B, SMARCE1/BAF57, BAF60 (one or more of SMARCD1/BAF60A, SMARCD2/BAF60B, or SMARCD3/BAF60C), SMARCC1/BAF155, SMARCC2/BAF170, ARID1A/BAF250A, SIN3A, HDAC1, HDAC2, and RBAP4. Component of the SWI/SNF complex Brg1(I), at least composed of SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, ACTL6A/BAF53A or ACTL6B/BAF53B, SMARCE1/BAF57, BAF60 (one or more of SMARCD1/BAF60A, SMARCD2/BAF60B, or SMARCD3/BAF60C), SMARCC1/BAF155, SMARCC2/BAF170, ARID1A/BAF250A, SIN3A, and probably HDAC2 and RBAP4. Component of the SWI/SNF Brg1(II), at least composed of SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, ACTL6A/BAF53A or ACTL6B/BAF53B, SMARCE1/BAF57, SMARCC1/BAF155, SMARCC2/BAF170, ARID1A/BAF250A and probably HDAC2 and RBAP4. Component of a SWI/SNF-like EPAFa complex, at least composed of SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, ACTL6A/BAF53A, SMARCE1/BAF57, SMARCD1/BAF60A, SMARCC1/BAF155, SMARCC2/BAF170, BAF250A and MLLT1/ENL. Component of a SWI/SNF-like complex containing ARID1A/BAF250A and ARID1B/BAF250B. Interacts through its C-terminus with SMARCA2/BRM/BAF190B and SMARCA4/BRG1/BAF190A. Interacts with SMARCC1/BAF155. Component of neural progenitors-specific chromatin remodeling complex (npBAF complex) composed of at least, ARID1A/BAF250A or ARID1B/BAF250B, SMARCD1/BAF60A, SMARCD3/BAF60C, SMARCA2/BRM/BAF190B, SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, SMARCC1/BAF155, SMARCE1/BAF57, SMARCC2/BAF170, PHF10/BAF45A, ACTL6A/BAF53A and actin. Component of neuron-specific chromatin remodeling complex (nBAF complex) composed of at least, ARID1A/BAF250A or ARID1B/BAF250B, SMARCD1/BAF60A, SMARCD3/BAF60C, SMARCA2/BRM/BAF190B, SMARCA4/BRG1/BAF190A, SMARCB1/BAF47, SMARCC1/BAF155, SMARCE1/BAF57, SMARCC2/BAF170, DPF1/BAF45B, DPF3/BAF45C, ACTL6B/BAF53B and actin (By similarity).
- SequenceCaution:
-
- Sequence=AAF75765.1; Type=Frameshift; Positions=374; Evidence={ECO:0000305}; Sequence=AAG33967.1; Type=Frameshift; Positions=872, 885; Evidence={ECO:0000305}; Sequence=BAA23269.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305}; Sequence=BAA83073.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=BAA83073.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305};
Protein Expression for ARID1A Gene
Post-translational modifications for ARID1A Gene
Other Protein References for ARID1A Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- EMD Millipore Complete listing of Mono and Polychlonal Antibodies for ARID1A
- Cell Signaling Technology (CST) Antibodies for ARID1A (ARID1A)
- Novus Biologicals Antibodies for ARID1A
- Invitrogen Antibodies for ARID1A
- antibodies-online Antibodies for ARID1A: See all 23
- GeneTex ARID1A antibody for ARID1A
-
Custom Antibody ServicesProSci Antibodies for ARID1A
-
Santa Cruz Biotechnology (SCBT) Antibodies for ARID1A
Protein Products
-
OriGene Purified Proteins for ARID1A
- Search Origene for MassSpec and Protein Over-expression Lysates for ARID1A
- Origene Custom Protein Services for ARID1A
- Search GeneTex for Proteins for ARID1A
Assay Products
- antibodies-online Kits for ARID1A: See all 5
No data available for DME Specific Peptides for ARID1A Gene
Domains & Families for ARID1A Gene
Gene Families for ARID1A Gene
Protein Domains for ARID1A Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for ARID1A Gene
Graphical View of Domain Structure for InterPro Entry
No data available for UniProtKB/Swiss-Prot for ARID1A Gene
Function for ARID1A Gene
Molecular function for ARID1A Gene
- UniProtKB/Swiss-Prot Function:
- Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Binds DNA non-specifically. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity).
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0003677 | DNA binding | IEA,NAS | 10757798 |
| GO:0003713 | transcription coactivator activity | NAS | 8804307 |
| GO:0005515 | protein binding | IPI | 11780067 |
| GO:0016922 | ligand-dependent nuclear receptor binding | IPI | 17363140 |
| GO:0031491 | nucleosome binding | IEA | -- |
Phenotypes for ARID1A Gene
- MGI mutant phenotypes for ARID1A:
-
inferred from 8 alleles
- mortality/aging
- cellular phenotype
- normal phenotype
- growth/size/body region phenotype
- immune system phenotype
- muscle phenotype
- nervous system phenotype
- homeostasis/metabolism phenotype
- cardiovascular system phenotype
- neoplasm
- reproductive system phenotype
- endocrine/exocrine gland phenotype
- vision/eye phenotype
- hearing/vestibular/ear phenotype
- skeleton phenotype
- embryo phenotype
- hematopoietic system phenotype
- craniofacial phenotype
- no phenotypic analysis
- GenomeRNAi human phenotypes for ARID1A:
-
- Increased viability
- Increased vaccinia virus (VACV) infection
- Mildly decreased CFP-tsO45G cell surface transport
- Decreased viability in esophageal squamous lineage
- Decreased viability ratio
- Decreased NF-kappaB reporter expression
- Increased transferrin (TF) endocytosis
- Increased shRNA abundance (Z-score > 2)
- Decreased homologous recombination repair frequency
- Increased Nanog expression
- Decreased shRNA abundance (Z-score < -2)
- Decreased HIV-1 infection
Animal Models for ARID1A Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for ARID1A
-
-
ViGene Biosciences lentiviral particle packaged cDNA for ARID1A gene
-
ViGene Biosciences ready-to-package AAV shRNAs for ARID1A gene
- Search ViGene Biosciences for ARID1A
CRISPR Products
-
OriGene CRISPR knockouts for ARID1A
-
Santa Cruz Biotechnology (SCBT) CRISPR for ARID1A
- GenScript: Design CRISPR guide RNA sequences for ARID1A
miRNA for ARID1A Gene
- miRTarBase miRNAs that target ARID1A
-
- hsa-mir-1-3p (MIRT001385)
- hsa-mir-101-3p (MIRT004027)
- hsa-mir-221-3p (MIRT024162)
- hsa-mir-98-5p (MIRT027653)
- hsa-mir-877-3p (MIRT036956)
- hsa-mir-296-3p (MIRT038464)
- hsa-mir-181a-2-3p (MIRT038669)
- hsa-mir-18a-3p (MIRT040907)
- hsa-mir-193b-3p (MIRT041580)
- hsa-mir-484 (MIRT042203)
- hsa-mir-324-3p (MIRT042943)
- hsa-mir-331-3p (MIRT043438)
- hsa-mir-92a-3p (MIRT049171)
- hsa-let-7e-5p (MIRT051608)
- hsa-mir-203a-3p (MIRT066772)
- hsa-mir-324-5p (MIRT066773)
- hsa-mir-891a-3p (MIRT066774)
- hsa-mir-3688-5p (MIRT066777)
- hsa-mir-4642 (MIRT066779)
- hsa-let-7a-2-3p (MIRT066782)
- hsa-let-7g-3p (MIRT066783)
- hsa-mir-144-3p (MIRT066784)
- hsa-mir-3177-5p (MIRT066789)
- hsa-mir-185-5p (MIRT066794)
- hsa-mir-135b-3p (MIRT066795)
- hsa-mir-561-5p (MIRT066796)
- hsa-mir-583 (MIRT066797)
- hsa-mir-609 (MIRT066798)
- hsa-mir-765 (MIRT066799)
- hsa-mir-3173-3p (MIRT066801)
- hsa-mir-4306 (MIRT066802)
- hsa-mir-3150b-3p (MIRT066803)
- hsa-mir-4644 (MIRT066805)
- hsa-mir-4784 (MIRT066806)
- hsa-mir-6891-5p (MIRT066808)
- hsa-mir-19a-5p (MIRT188326)
- hsa-mir-19b-1-5p (MIRT188327)
- hsa-mir-19b-2-5p (MIRT188328)
- hsa-mir-507 (MIRT188332)
- hsa-mir-557 (MIRT188333)
- hsa-mir-450b-5p (MIRT188334)
- hsa-mir-876-3p (MIRT188335)
- hsa-mir-3680-3p (MIRT188336)
- hsa-mir-4649-3p (MIRT188337)
- hsa-mir-6134 (MIRT188339)
- hsa-mir-7162-3p (MIRT188342)
- hsa-mir-488-3p (MIRT188343)
- hsa-mir-5681a (MIRT188344)
- hsa-mir-4666a-3p (MIRT188347)
- hsa-mir-1182 (MIRT248727)
- hsa-mir-31-5p (MIRT248732)
- hsa-mir-485-3p (MIRT339122)
- hsa-mir-539-3p (MIRT339123)
- hsa-mir-664a-3p (MIRT339131)
- hsa-mir-1266-5p (MIRT405480)
- hsa-mir-4518 (MIRT405481)
- hsa-mir-4695-3p (MIRT405482)
- hsa-mir-6823-5p (MIRT405483)
- hsa-mir-7641 (MIRT405484)
- hsa-mir-7854-3p (MIRT405485)
- hsa-mir-218-5p (MIRT441191)
- hsa-mir-127-5p (MIRT441193)
- hsa-mir-3613-5p (MIRT481593)
- hsa-mir-3664-3p (MIRT481594)
- hsa-mir-6830-5p (MIRT481595)
- hsa-mir-377-3p (MIRT481596)
- hsa-mir-3190-3p (MIRT494688)
- hsa-mir-3202 (MIRT494689)
- hsa-mir-4533 (MIRT494690)
- hsa-mir-4768-3p (MIRT494691)
- hsa-mir-3618 (MIRT562638)
- hsa-mir-6730-5p (MIRT562639)
- hsa-mir-4708-3p (MIRT562640)
- hsa-mir-548x-3p (MIRT562641)
- hsa-mir-548j-3p (MIRT562642)
- hsa-mir-548aq-3p (MIRT562643)
- hsa-mir-548am-3p (MIRT562644)
- hsa-mir-548aj-3p (MIRT562645)
- hsa-mir-548ah-3p (MIRT562646)
- hsa-mir-548ae-3p (MIRT562647)
- hsa-mir-548z (MIRT562648)
- hsa-mir-548h-3p (MIRT562649)
- hsa-mir-548d-3p (MIRT562650)
- hsa-mir-548bb-3p (MIRT562651)
- hsa-mir-548ac (MIRT562652)
- hsa-mir-448 (MIRT562653)
- hsa-mir-196a-3p (MIRT562654)
- hsa-mir-5692a (MIRT562655)
- hsa-mir-153-3p (MIRT562656)
- hsa-mir-4303 (MIRT568486)
- hsa-mir-5583-5p (MIRT660533)
- hsa-mir-3129-3p (MIRT660534)
- hsa-mir-4652-3p (MIRT689021)
- hsa-mir-4743-3p (MIRT689022)
- hsa-mir-628-5p (MIRT689023)
- hsa-mir-7114-3p (MIRT689024)
- hsa-mir-1180-5p (MIRT689025)
- hsa-mir-4750-3p (MIRT689026)
miRNA Products
- Search ViGene Biosciences for ARID1A
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for ARID1A
- Browse OriGene Inhibitory RNA Products For ARID1A
-
ViGene Biosciences ready-to-package AAV shRNAs for ARID1A gene
Clone Products
- Addgene plasmids for ARID1A
- VectorBuilder custom plasmid, inducible vectors for ARID1A
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ARID1A
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Cell Line Products
-
ViGene Biosciences adenoviral particle packaged cDNA for ARID1A gene
-
ViGene Biosciences lentiviral particle packaged cDNA for ARID1A gene
-
ViGene Biosciences ready-to-package AAV shRNAs for ARID1A gene
Flow Cytometry Products
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for ARID1A Gene
Localization for ARID1A Gene
Subcellular locations from UniProtKB/Swiss-Prot for ARID1A Gene
- Nucleus.
| Compartment | Confidence |
|---|---|
| nucleus | 5 |
| cytosol | 2 |
| plasma membrane | 1 |
| extracellular | 1 |
| peroxisome | 1 |
| endoplasmic reticulum | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000790 | nuclear chromatin | IDA | 17363140 |
| GO:0005634 | nucleus | TAS | 12200431 |
| GO:0005654 | nucleoplasm | IDA | -- |
| GO:0016514 | SWI/SNF complex | IDA | 8804307 |
| GO:0071564 | npBAF complex | ISS | -- |
Pathways & Interactions for ARID1A Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Chromatin organization | ||
| 2 | Transcription Ligand-dependent activation of the ESR1/SP pathway | ||
| 3 | Chromatin Regulation / Acetylation | ||
| 4 | AMPK Enzyme Complex Pathway | ||
| 5 | PEDF Induced Signaling | ||
Pathways by source for ARID1A Gene
1 Cell Signaling Technology pathway for ARID1A Gene
1 BioSystems pathway for ARID1A Gene
3 Reactome pathways for ARID1A Gene
2 GeneGo (Thomson Reuters) pathways for ARID1A Gene
2 Qiagen pathways for ARID1A Gene
Interacting Proteins for ARID1A Gene
Selected Interacting proteins:
O14497-ARI1A_HUMAN
ENSP00000320485
for ARID1A Gene via
MINT
STRING
IID
UniProtKB
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000122 | negative regulation of transcription from RNA polymerase II promoter | IEA | -- |
| GO:0001704 | formation of primary germ layer | IEA | -- |
| GO:0001843 | neural tube closure | IEA | -- |
| GO:0003205 | cardiac chamber development | IEA | -- |
| GO:0003408 | optic cup formation involved in camera-type eye development | IEA | -- |
No data available for SIGNOR curated interactions for ARID1A Gene
Transcripts for ARID1A Gene
mRNA/cDNA for ARID1A Gene
- (3) REFSEQ mRNAs :
- (13) Additional mRNA sequences :
- (408) Selected AceView cDNA sequences:
- (17) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for ARID1A Gene
CRISPR Products
-
OriGene CRISPR knockouts for ARID1A
-
Santa Cruz Biotechnology (SCBT) CRISPR for ARID1A
- GenScript: Design CRISPR guide RNA sequences for ARID1A
miRNA Products
- Search ViGene Biosciences for ARID1A
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for ARID1A
- Browse OriGene Inhibitory RNA Products For ARID1A
-
ViGene Biosciences ready-to-package AAV shRNAs for ARID1A gene
Clone Products
- Addgene plasmids for ARID1A
- VectorBuilder custom plasmid, inducible vectors for ARID1A
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ARID1A
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Flow Cytometry Products
| ExUns: | 1 | ^ | 2 | ^ | 3 | ^ | 4a | · | 4b | ^ | 5 | ^ | 6a | · | 6b | ^ | 7 | ^ | 8a | · | 8b | ^ | 9 | ^ | 10 | ^ | 11 | ^ | 12 | ^ | 13 | ^ | 14a | · | 14b | ^ | 15a | · | 15b | · | 15c | ^ | 16 | ^ | 17a | · | 17b | ^ | 18 | ^ | 19a | · |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP2: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP3: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP4: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP5: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP6: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP7: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP8: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP9: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP10: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP11: | - | |||||||||||||||||||||||||||||||||||||||||||||||||||
| SP12: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP13: |
| ExUns: | 19b | · | 19c | · | 19d | ^ | 20 | ^ | 21 | ^ | 22a | · | 22b | ^ | 23 | ^ | 24 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | |||||||||||||||||
| SP2: | |||||||||||||||||
| SP3: | |||||||||||||||||
| SP4: | |||||||||||||||||
| SP5: | |||||||||||||||||
| SP6: | |||||||||||||||||
| SP7: | |||||||||||||||||
| SP8: | |||||||||||||||||
| SP9: | - | - | |||||||||||||||
| SP10: | |||||||||||||||||
| SP11: | |||||||||||||||||
| SP12: | |||||||||||||||||
| SP13: |
Expression for ARID1A Gene
This gene is overexpressed in Peripheral blood mononuclear cells (12.9), CD8 Tcells (10.6), and Monocytes (6.9).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for ARID1A Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of ARID1A Gene:
ARID1ASOURCE GeneReport for Unigene cluster for ARID1A Gene:
Hs.468972mRNA Expression by UniProt/SwissProt for ARID1A Gene:
O14497-ARI1A_HUMAN
Tissue specificity:
Highly expressed in spleen, thymus, prostate, testis, ovary, small intestine, colon, and PBL, and at a much lower level in heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas.
Evidence on tissue expression from TISSUES for ARID1A Gene
- Nervous system(4.8)
- Liver(4.4)
- Stomach(4.4)
- Intestine(3)
- Muscle(2.3)
- Blood(2.2)
- Heart(2.1)
- Lung(2.1)
- Lymph node(2.1)
Phenotype-based relationships between genes and organs from Gene ORGANizer for ARID1A Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- cardiovascular
- digestive
- immune
- integumentary
- nervous
- reproductive
- respiratory
- skeletal muscle
- skeleton
- urinary
Organs:
Head and neck:
- brain
- cerebellum
- cheek
- chin
- cranial nerve
- ear
- eye
- eyelid
- face
- forehead
- head
- jaw
- lip
- mandible
- maxilla
- mouth
- neck
- nose
- outer ear
- pharynx
- scalp
- skull
- tooth
Thorax:
- chest wall
- clavicle
- diaphragm
- esophagus
- heart
- heart valve
- lung
- rib
- rib cage
- scapula
- sternum
Abdomen:
- abdominal wall
- biliary tract
- duodenum
- intestine
- kidney
- large intestine
- liver
- pancreas
- small intestine
- stomach
Pelvis:
- pelvis
- penis
- rectum
- testicle
- ureter
- urethra
- uterus
Limb:
- ankle
- arm
- digit
- elbow
- femur
- fibula
- finger
- foot
- forearm
- hand
- hip
- humerus
- knee
- lower limb
- nail
- radius
- shin
- shoulder
- thigh
- tibia
- toe
- ulna
- upper limb
- wrist
General:
- blood
- blood vessel
- hair
- peripheral nervous system
- skin
- spinal column
- spinal cord
- vertebrae
- white blood cell
Primer Products
-
OriGene qPCR primer pairs for ARID1A
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for ARID1A Gene
Orthologs for ARID1A Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | ARID1A 34 35 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | -- 35 |
|
OneToMany | |
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| -- 35 |
|
OneToMany | |||
| dog (Canis familiaris) |
Mammalia | ARID1A 34 35 |
|
||
| cow (Bos Taurus) |
Mammalia | ARID1A 34 35 |
|
||
| mouse (Mus musculus) |
Mammalia | Arid1a 34 16 35 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | ARID1A 35 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Arid1a 34 |
|
||
| chicken (Gallus gallus) |
Aves | -- 35 |
|
OneToMany | |
| ARID1A 34 |
|
||||
| -- 35 |
|
OneToMany | |||
| lizard (Anolis carolinensis) |
Reptilia | ARID1A 35 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | arid1a 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | arid1ab 34 35 |
|
||
| arid1aa 35 |
|
OneToMany | |||
| Dr.26931 34 |
|
||||
| rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.12620 34 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | osa 35 |
|
OneToMany | |
| worm (Caenorhabditis elegans) |
Secernentea | let-526 35 |
|
OneToMany | |
| sea squirt (Ciona savignyi) |
Ascidiacea | CSA.335 35 |
|
OneToOne |
- Species where no ortholog for ARID1A was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for ARID1A Gene
(2) SIMAP similar genes for ARID1A Gene using alignment to 8 proteins:
Variants for ARID1A Gene
| SNP ID | Clin | Chr 01 pos | Sequence Context | AA Info | Type |
|---|---|---|---|---|---|
| rs387906845 | Pathogenic | 26,766,246(+) | TGAAT(C/T)AAGGG | reference, stop-gained | |
| rs387906846 | Pathogenic | 26,773,716(+) | AGCAA(C/G/T)GGTGA | reference, missense, stop-gained | |
| rs797045262 | Pathogenic | 26,696,434(+) | CCGCC(-/AGCAGCCTGGGCAACCCGCCGCCGCC)GCCGC | reference, frameshift-variant | |
| rs797045263 | Pathogenic | 26,696,797(+) | ATGGG(-/G)TGGGG | reference, frameshift-variant | |
| rs875989848 | Pathogenic | 26,697,516(+) | GGGGG(-/G)CAGCC | reference, frameshift-variant |
Residual Variation Intolerance Score:
0.602% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
4.24;
62.36% of all genes are more intolerant (likely to be disease-causing)
Relevant External Links for ARID1A Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ARID1A Gene
Disorders for ARID1A Gene
(16) MalaCards diseases for ARID1A Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| mental retardation, autosomal dominant 14 |
|
|
| coffin-siris syndrome |
|
|
| arid1a-related coffin-siris syndrome |
|
|
| ovarian clear cell carcinoma |
|
|
| ovarian clear cell adenocarcinoma |
|
|
Search ARID1A in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
ARI1A_HUMAN- Coffin-Siris syndrome 2 (CSS2) [MIM:614607]: A form of Coffin-Siris syndrome, a congenital multiple malformation syndrome with broad phenotypic and genetic variability. Cardinal features are intellectual disability, coarse facial features, hypertrichosis, and hypoplastic or absent fifth digit nails or phalanges. Additional features include malformations of the cardiac, gastrointestinal, genitourinary, and/or central nervous systems. Sucking/feeding difficulties, poor growth, ophthalmologic abnormalities, hearing impairment, and spinal anomalies are common findings. Both autosomal dominant and autosomal recessive inheritance patterns have been reported. {ECO:0000269 PubMed:22426308}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Relevant External Links for ARID1A
- Atlas of Genetics and Cytogenetics in Oncology and Haematology:
- ARID1A
No data available for Genatlas for ARID1A Gene
Publications for ARID1A Gene
- Characterization of mammalian orthologues of the Drosophila osa gene: cDNA cloning, expression, chromosomal localization, and direct physical interaction with Brahma chromatin-remodeling complex. (PMID: 11318604) Kozmik Z. … Vlcek C. (Genomics 2001) 3 4 22 64
- The human SWI-SNF complex protein p270 is an ARID family member with non-sequence-specific DNA binding activity. (PMID: 10757798) Dallas P.B. … Moran E. (Mol. Cell. Biol. 2000) 3 4 22 64
- Molecular cloning and expression of a novel human cDNA containing CAG repeats. (PMID: 9434167) Takeuchi T. … Ohtsuki Y. (Gene 1997) 2 3 4 64
- Identification and functional characterization of a novel bipartite nuclear localization sequence in ARID1A. (PMID: 26614907) Bateman N.W. … Conrads T.P. (Biochem. Biophys. Res. Commun. 2016) 3 4 64
- Somatic mutations in the chromatin remodeling gene ARID1A occur in several tumor types. (PMID: 22009941) Jones S. … Papadopoulos N. (Hum. Mutat. 2012) 3 4 64
Products for ARID1A Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for ARID1A
- Search Origene for MassSpec and Protein Over-expression Lysates for ARID1A
- Origene Custom Protein Services for ARID1A
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for ARID1A
- Browse OriGene Inhibitory RNA Products For ARID1A
- OriGene qPCR primer pairs for ARID1A
- OriGene CRISPR knockouts for ARID1A
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For ARID1A
- GenScript: Next-day shipping cDNA ORF clone for ARID1A in any vector
- GenScript Custom Purified and Recombinant Proteins Services for ARID1A
- GenScript Custom Assay Services for ARID1A
- GenScript Custom overexpressing Cell Line Services for ARID1A
- GenScript: Design CRISPR guide RNA sequences for ARID1A
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for ARID1A
- Cell Signaling Technology (CST) Antibodies for ARID1A (ARID1A)
- Search for Antibodies & Assays
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Proteins
- Sino Biological Antibodies
- Sino Biological ELISA Kits and Pair Sets
- Sino Biological Cell Lysates
- Sino Biological qPCR Primers
- Sino Biological CRO Services for Proteins, Antibodies and Genes
- Sino Biological Transfection Reagents
- Novus Biologicals Antibodies for ARID1A
- Novus Biologicals proteins and lysates for ARID1A
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Invitrogen Antibodies for ARID1A
- Addgene plasmids for ARID1A
- antibodies-online Antibodies for ARID1A: See all 23
- antibodies-online Kits for ARID1A: See all 5
- Search antibodies-online for proteins
- Search antibodies-online for peptides
- GeneTex ARID1A antibody for ARID1A
- Search GeneTex for Proteins for ARID1A
- ViGene Biosciences adenoviral particle packaged cDNA for ARID1A gene
- ViGene Biosciences lentiviral particle packaged cDNA for ARID1A gene
- ViGene Biosciences ready-to-package AAV shRNAs for ARID1A gene
- Search ViGene Biosciences for ARID1A
- Santa Cruz Biotechnology (SCBT) Antibodies for ARID1A
- Search Santa Cruz Biotechnology (SCBT) for ARID1A siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for ARID1A
- Custom Antibody ServicesProSci Antibodies for ARID1A
- Search for ARID1A Proteins at ProSci
- Cyagen custom Knockout/knockin (KOKI) mouse models for ARID1A
- VectorBuilder custom plasmid, inducible vectors for ARID1A
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ARID1A
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Sources for ARID1A Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) RNAdb
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) CGAP SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) GeneTests
- (45) HGMD
- (46) GAD
- (47) LSDB
- (48) BGMUT
- (49) HuGE
- (50) eBioscience
- (51) Atlas
- (52) Cell Signaling Technology
- (53) GenBank
- (54) H-invDB
- (55) HORDE
- (56) HUGE
- (57) IMGT
- (58) Leiden
- (59) MILLIPORE
- (60) miRBase
- (61) DME
- (62) NCBI
- (63) OriGene
- (64) PubMed
- (65) R&D Systems
- (66) TGDB
- (67) Tocris
- (68) Abcam
- (69) Novus
- (70) ProSpec
- (71) Sino Biological
- (72) GenScript
- (73) Qiagen
- (74) Cloud-Clone Corp.
- (75) Enzo Life Sciences
- (76) OCA
- (77) Proteopedia
- (78) MOPED
- (79) SPIRE
- (80) neXtProt
- (81) Reactome
- (82) GeneGo (Thomson Reuters)
- (83) fRNAdb
- (84) DISEASES
- (85) SIMAP
- (86) GenomeRNAi
- (87) LifeMap
- (88) miRTarBase
- (89) MalaCards
- (90) Invitrogen
- (91) BitterDB
- (92) Vector BioLabs
- (93) ESI-BIO
- (94) RefSeq
- (95) BioSystems
- (96) MaxQB
- (97) IUPHAR
- (98) BioGPS
- (99) Illumina
- (100) COMPARTMENTS
- (101) HOMER
- (102) PaxDb
- (103) ApexBio
- (104) Addgene
- (105) antibodies-online
- (106) CYP
- (107) NONCODE
- (108) SwitchGear Genomics
- (109) TreeFam
- (110) PathCards
- (111) GeneReviews
- (112) GeneTex
- (113) Taconic Biosciences
- (114) GTEx
- (115) ProteomicsDB
- (116) SCBT
- (117) DGIdb
- (118) ClinicalTrials
- (119) FDA Approved Drugs
- (120) RVIS
- (121) SIGNOR
- (122) diseasecard
- (123) NIH Rare Diseases
- (124) Orphanet
- (125) UMLS
- (126) GTR
- (127) Disease Ontology
- (128) Genetics Home Reference
- (129) MeSH
- (130) MedlinePlus
- (131) CDC
- (132) NINDS
- (133) NCBI Bookshelf
- (134) ClinVar
- (135) Gene Damage Index
- (136) ViGene Biosciences
- (137) HPO
- (138) UDN
- (139) VISTA
- (140) FANTOM5
- (141) ENCODE
- (142) ProSci
- (143) Horizon
- (144) NURSA
- (145) IID
- (146) Cyagen
- (147) VectorBuilder
- (148) SNPedia
- (149) BRCA Exchange
- (150) St John's Lab
- (151) CIViC
- (152) ProteoGenix
- (153) dbSUPER
- (154) TISSUES
- (155) Gene ORGANizer