Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

ARHGEF12 Gene

protein-coding   GIFtS: 66
GCID: GC11P120207

Rho guanine nucleotide exchange factor (GEF) 12

 Explore 17 diseases affiliated with
ARHGEF12 via our new
 Human Malady Compendium 
Biological research products
for ARHGEF12
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Rho Guanine Nucleotide Exchange Factor (GEF) 121 2     PRO27922
LARG1 2 3 5     Leukemia-Associated Rho Guanine Nucleotide Exchange Factor2
KIAA03821 3 5     Rho Guanine Nucleotide Exchange Factor 122
Leukemia-Associated RhoGEF2 3     

External Ids:    HGNC: 141931   Entrez Gene: 233652   Ensembl: ENSG000001969147   OMIM: 6047635   UniProtKB: Q9NZN53   

Export aliases for ARHGEF12 gene to outside databases

Previous GC identifers: GC11P122207 GC11P121719 GC11P120241 GC11P119745 GC11P119712 GC11P116148


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for ARHGEF12:
Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working
through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate
Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid
leukemia. Two transcript variants encoding different isoforms have been found for this gene. (provided by RefSeq, Nov
2010)

UniProtKB/Swiss-Prot: ARHGC_HUMAN, Q9NZN5
Function: May play a role in the regulation of RhoA GTPase by guanine nucleotide-binding alpha-12 (GNA12) and alpha-13
(GNA13). Acts as guanine nucleotide exchange factor (GEF) for RhoA GTPase and may act as GTPase-activating protein
(GAP) for GNA12 and GNA13

Gene Wiki entry for ARHGEF12


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000011.9  NC_018922.1  NT_033899.8  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the ARHGEF12 gene promoter:
         AML1a   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidARHGEF12 promoter sequence
   Search SABiosciences Chromatin IP Primers for ARHGEF12

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ARHGEF12


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 11q23.3   Ensembl cytogenetic band:  11q23.3   HGNC cytogenetic band: 11q23.3

ARHGEF12 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ARHGEF12 gene location

GeneLoc information about chromosome 11         GeneLoc Exon Structure

GeneLoc location for GC11P120207:  view genomic region     (about GC identifiers)

Start:
120,207,787 bp from pter      End:
120,360,645 bp from pter
Size:
152,859 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: ARHGC_HUMAN, Q9NZN5 (See protein sequence)
Recommended Name: Rho guanine nucleotide exchange factor 12  
Size: 1544 amino acids; 173232 Da
Subunit: Interacts with GNA12 and GNA13, probably through the RGS-like domain. Interacts with RHOA, PLXNB1 and PLXNB2.
Interacts through its PDZ domain with IGF1R beta subunit. Interacts with GCSAM
Subcellular location: Cytoplasm (Probable). Membrane (Probable). Note=Translocated to the membrane upon stimulation
(Probable)
Sequence caution: Sequence=AAH63117.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A
sequence;
4 PDB 3D structures from and Proteopedia for ARHGEF12:
1TXD (3D)        1X86 (3D)        2OMJ (3D)        2OS6 (3D)    
Secondary accessions: O15086 Q6P526
Alternative splicing: 2 isoforms:  Q9NZN5-1   Q9NZN5-2   (Contains a phosphoserine at position 41)

Explore the universe of human proteins at neXtProt for ARHGEF12: NX_Q9NZN5

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q9NZN5

  • ARHGEF12 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins (2 alternative transcripts): 
    NP_001185594.1  NP_056128.1  

    ENSEMBL proteins: 
     ENSP00000380942   ENSP00000432984   ENSP00000349056  
    Reactome Protein details: Q9NZN5
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom Protein Services for ARHGEF12 
    GenScript Custom Purified and Recombinant Proteins Services for ARHGEF12
    Novus Biologicals ARHGEF12 Protein
    Novus Biologicals ARHGEF12 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for ARHGEF12

    Gene Ontology (GO): 3 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005737cytoplasm IDA15755723
    GO:0005829cytosol TAS--
    GO:0016020membrane IEA--


    ARHGEF12 for ontologies           About GeneDecksing



    ARHGEF12 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    R&D Systems Antibodies for ARHGEF12 (LARG)
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for ARHGEF12 
    GenScript Custom Superior Antibodies Services for ARHGEF12
    Novus Biologicals ARHGEF12 Antibodies
    Search for Antibodies for ARHGEF12 at Abcam  
    Uscn Antibodies for ARHGEF12
    Search ThermoFisher Antibodies for ARHGEF12

    Assay Products for ARHGEF12: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ARHGEF12
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for ARHGEF12


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    ARHGEF12 for domains           About GeneDecksing

    5/8 InterPro domains/families (see all 8):
     IPR001331 GDS_CDC24_CS
     IPR015212 Regulat_G_prot_signal-like
     IPR001478 PDZ
     IPR000219 DH-domain
     IPR001849 Pleckstrin_homology

    Graphical View of Domain Structure for InterPro Entry Q9NZN5

    ProtoNet protein and cluster: Q9NZN5

    3 Blocks protein families:
    IPB000219 DH domain
    IPB001478 PDZ/DHR/GLGF domain
    IPB001849 Pleckstrin-like


    UniProtKB/Swiss-Prot: ARHGC_HUMAN, Q9NZN5
    Similarity: Contains 1 DH (DBL-homology) domain
    Similarity: Contains 1 PDZ (DHR) domain
    Similarity: Contains 1 PH domain
    Similarity: Contains 1 RGSL (RGS-like) domain


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: ARHGC_HUMAN, Q9NZN5
    Function: May play a role in the regulation of RhoA GTPase by guanine nucleotide-binding alpha-12 (GNA12) and alpha-13
    (GNA13). Acts as guanine nucleotide exchange factor (GEF) for RhoA GTPase and may act as GTPase-activating protein
    (GAP) for GNA12 and GNA13

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: ARHGEF12
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ARHGEF12
    8/136 QIAGEN miScript miRNA Assays for microRNAs that regulate ARHGEF12 (see all 136):
    hsa-miR-100* hsa-miR-361-5p hsa-miR-193a-3p hsa-miR-199a-3p hsa-miR-1245 hsa-miR-138-2* hsa-miR-3921 hsa-miR-4273
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ARHGEF12 (see all 7)
    OriGene shRNA RFP: ARHGEF12
    OriGene siRNA: ARHGEF12
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ARHGEF12

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ARHGEF12

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ARHGEF12 (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ARHGEF12
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 2): ARHGEF12 (NM_001198665)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ARHGEF12
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ARHGEF12 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ARHGEF12
    Search LifeMap BioReagents cell lines for ARHGEF12

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ARHGEF12

    Gene Ontology (GO): 5 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001664G-protein coupled receptor binding IDA15755723
    GO:0005089Rho guanyl-nucleotide exchange factor activity IEA--
    GO:0005096GTPase activator activity IEA--
    GO:0005515protein binding IPI--
    GO:0005543phospholipid binding IEA--


    ARHGEF12 for ontologies           About GeneDecksing


    4 GenomeRNAi human phenotypes for ARHGEF12:
     Decreased focal adhesion (FA)   Decreased p24 protein expressi  Increased S DNA content  Upregulation of Wnt/beta-caten 

    Animal Models:
         Mouse knock-out Arhgef12tm1Soff for ARHGEF12
         5 MGI mutant phenotypes (inferred from 2 alleles(MGI details for Arhgef12):
     cardiovascular system  cellular  hematopoietic system  immune system  muscle 

    ARHGEF12 for phenotypes           About GeneDecksing


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways - 5/29 super-pathways (see all 29About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Cell death signalling via NRAGE, NRIF and NADE
    Cell death signalling via NRAGE, NRIF and NADE1.00
    G alpha (12/13) signalling events0.39
    NRAGE signals death through JNK0.74
    Rho GTPase cycle0.25
    p75 NTR receptor-mediated signalling0.73
    Signaling by Rho GTPases0.25
    2G-protein signaling_Regulation of p38 and JNK signaling mediated by G-proteins
    G-protein signaling Regulation of p38 and JNK signaling mediated by G-proteins1.00
    G-protein signaling_G-Protein alpha-12 signaling pathway0.40
    G-protein signaling_Regulation of p38 and JNK signaling mediated by G-proteins1.00
    G-protein signaling G-Protein alpha-12 signaling pathway0.40
    3GPCR Pathway
    GPCR Pathway1.00
    Breast Cancer Regulation by Stathmin10.58
    Ras Pathway0.62
    Pancreatic Adenocarcinoma0.55
    4Sema4D in semaphorin signaling
    Sema4D in semaphorin signaling1.00
    Semaphorin interactions0.44
    Sema4D induced cell migration and growth-cone collapse0.83
    5Signaling by GPCR
    Signaling by GPCR1.00
    Signal Transduction0.56
    GPCR downstream signaling0.89

    Pathway sources
    See GeneCards unified pathways
    Show all pathways

    5 EMD Millipore Pathways for ARHGEF12
        G-protein signaling Regulation of p38 and JNK signaling mediated by G-proteins
    Neurophysiological process Receptor-mediated axon growth repulsion
    G-protein signaling G-Protein alpha-q signaling cascades
    G-protein signaling G-Protein alpha-12 signaling pathway
    G-protein signaling RhoA regulation pathway

    5/22 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for ARHGEF12 (see all 22)
        RhoA Pathway
    Guidance Cues and Growth Cone Motility
    Molecular Mechanisms of Cancer
    Semaphorin Signaling
    Interferon Pathway

    5 GeneGo (Thomson Reuters) Pathways for ARHGEF12
        Neurophysiological process Receptor-mediated axon growth repulsion
    G-protein signaling G-Protein alpha-q signaling cascades
    G-protein signaling Regulation of p38 and JNK signaling mediated by G-proteins
    G-protein signaling RhoA regulation pathway
    G-protein signaling G-Protein alpha-12 signaling pathway

    1 BioSystems Pathway for ARHGEF12 
        Regulation of RhoA activity

    5/15        Reactome Pathways for ARHGEF12 (see all 15)
        GPCR downstream signaling
    Signaling by Rho GTPases
    Developmental Biology
    G alpha (12/13) signalling events
    Cell death signalling via NRAGE, NRIF and NADE


    4         Kegg Pathways  (Kegg details for ARHGEF12):
        Vascular smooth muscle contraction
    Axon guidance
    Regulation of actin cytoskeleton
    Tuberculosis


    ARHGEF12 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for ARHGEF12

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/31 Interacting proteins for ARHGEF12 (Q9NZN52, 3 ENSP000003809424) via UniProtKB, MINT, STRING, and/or I2D (see all 31)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    RHOAP615862, 3, ENSP000004001754MINT-7949974 I2D: score=5 STRING: ENSP00000400175
    IGF1RP080692, 3, ENSP000002680354MINT-1774956 MINT-1774857 MINT-1774918 MINT-1774802 MINT-1774883 MINT-1774936 MINT-1774976 I2D: score=3 STRING: ENSP00000268035
    PLXNB1O431573, ENSP000002964404I2D: score=3 STRING: ENSP00000296440
    CUL3Q136183, ENSP000002644144I2D: score=1 STRING: ENSP00000264414
    LPAR2Q9HBW03, ENSP000003846654I2D: score=1 STRING: ENSP00000384665
    About this table

    Gene Ontology (GO): 5/9 biological process terms (GO ID links to tree view) (see all 9):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006915apoptotic process TAS--
    GO:0007186G-protein coupled receptor signaling pathway IDA15755723
    GO:0007264small GTPase mediated signal transduction TAS--
    GO:0007411axon guidance TAS--
    GO:0035023regulation of Rho protein signal transduction IEA--


    ARHGEF12 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    ARHGEF12 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for ARHGEF12

    3 HMDB Compounds for ARHGEF12    About this table
    CompoundSynonyms CAS #PubMed Ids
    Guanosine diphosphate5'-GDP (see all 10)146-91-8--
    Guanosine monophosphate5'-GMP (see all 14)85-32-5--
    Guanosine triphosphate5'-GTP (see all 10)86-01-1--
    6 Novoseek chemical compound relationships for ARHGEF12 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    arginine 73 137 11373293 (9), 14513355 (7), 12515866 (6), 16644711 (6) (see all 25)
    gdp 53 1 14513355 (1)
    gtp 51.6 1 14513355 (1)
    tyrosine 33 6 11799111 (2), 12515866 (2), 19273616 (1)
    oligonucleotide 7.01 1 15143072 (1)
    calcium 0 1 16565089 (1)

    Search CenterWatch for drugs/clinical trials and news about ARHGEF12 / ARHGC 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for ARHGEF12 gene (2 alternative transcripts): 
    NM_001198665.1  NM_015313.2  

    Unigene Cluster for ARHGEF12:

    Rho guanine nucleotide exchange factor (GEF) 12
    Hs.24598  [show with all ESTs]
    Unigene Representative Sequence: NM_015313
    13 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000397843(uc021qrm.1 uc001pxl.2 uc009zat.3 uc009zau.1)
    ENST00000532993 ENST00000529970(uc010rzn.1) ENST00000530388 ENST00000528225
    ENST00000525960 ENST00000532823 ENST00000525222 ENST00000530747 ENST00000531616
    ENST00000526067 ENST00000528681 ENST00000356641

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: ARHGEF12
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ARHGEF12
    8/136 QIAGEN miScript miRNA Assays for microRNAs that regulate ARHGEF12 (see all 136):
    hsa-miR-100* hsa-miR-361-5p hsa-miR-193a-3p hsa-miR-199a-3p hsa-miR-1245 hsa-miR-138-2* hsa-miR-3921 hsa-miR-4273
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ARHGEF12 (see all 7)
    OriGene shRNA RFP: ARHGEF12
    OriGene siRNA: ARHGEF12
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ARHGEF12
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ARHGEF12 (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ARHGEF12
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 2): ARHGEF12 (NM_001198665)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ARHGEF12
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ARHGEF12 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ARHGEF12
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ARHGEF12
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ARHGEF12
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ARHGEF12

    Additional cDNA sequence: 

    AB002380.2 AF090906.1 AF180681.1 AK294803.1 AK304316.1 AL080067.1 AL137456.1 BC016718.1 
    BC031784.1 BC063117.1 BX647785.1 BX648515.1 

    22 DOTS entries:

    DT.100735447  DT.453032  DT.100688036  DT.99937482  DT.70102520  DT.95153541  DT.95304734  DT.100688274 
    DT.75122045  DT.91683226  DT.120698640  DT.95196175  DT.95304729  DT.99999404  DT.100694644  DT.120698557 
    DT.40110111  DT.406771  DT.75155575  DT.91767532  DT.91767577  DT.120698572 

    24/371 AceView cDNA sequences (see all 371):

    AA779138 AF180681 AA907218 Z45421 AI383200 BG654675 BM090778 BU731795 
    F11453 AA459205 CB305981 BM982172 AI422244 BM707930 BP340780 AI762631 
    AI628156 BU630600 H69692 CB306555 AA370360 AW293491 AI640467 Z41132 

    GeneLoc Exon Structure

    4 Alternative Splicing Database (ASD) splice patterns (SP) for ARHGEF12    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b ^ 14 ^ 15 ^ 16a · 16b ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23 ^
    SP1:                                -                                                                             -                                             
    SP2:        -                       -                                                                             -                                             
    SP3:                                                                                                                                                            
    SP4:                                                                                                                                                            

    ExUns: 24 ^ 25 ^ 26 ^ 27 ^ 28 ^ 29 ^ 30 ^ 31 ^ 32 ^ 33 ^ 34 ^ 35 ^ 36 ^ 37 ^ 38 ^ 39
    SP1:                                                                                                
    SP2:                                                                                                
    SP3:                                                                                                
    SP4:                                                                                                


    ECgene alternative splicing isoforms for ARHGEF12

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    ARHGEF12 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TATTTTTACT

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See ARHGEF12 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for ARHGEF12

    SOURCE GeneReport for Unigene cluster: Hs.24598

    UniProtKB/Swiss-Prot: ARHGC_HUMAN, Q9NZN5
    Tissue specificity: Ubiquitously expressed. Isoform 2 is found in jejunum and testis

        SABiosciences Custom PCR Arrays for ARHGEF12
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ARHGEF12
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ARHGEF12
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ARHGEF12
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ARHGEF12
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ARHGEF12

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for ARHGEF12 gene from 6/20 species (see all 20)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves ARHGEF121 Rho guanine nucleotide exchange factor (GEF) 12 72.81(n)
    73.1(a)
      419752  XM_417890.3  XP_417890.3 
    lizard
    (Anolis carolinensis)
    Reptilia ARHGEF126
    --
    69(a)
    1 ↔ 1
    LGa(1426352-1479725)
    African clawed frog
    (Xenopus laevis)
    Amphibia Larg2 guanine nucleotide exchange factor 76.67(n)    AY211396.1 
    zebrafish
    (Danio rerio)
    Actinopterygii LOC5624551 rho guanine nucleotide exchange factor 12-like 59.64(n)
    56.73(a)
      562455  XM_003200044.1  XP_003200092.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta RhoGEF23 gastrulation diacylglycerol binding 37(a)     --
    worm
    (Caenorhabditis elegans)
    Secernentea F13E6.63 Tiam-1 like protein 37(a)   X(10733408-10738294)   --


    ENSEMBL Gene Tree for ARHGEF12 (if available)
    TreeFam Gene Tree for ARHGEF12 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for ARHGEF12 gene
    ARHGEF22  ARHGEF32  ARHGEF112  NET12  ARHGEF12  ARHGEF182  AKAP132  ARHGEF282  
    4 SIMAP similar genes for ARHGEF12 using alignment to 2 protein entries:     ARHGC_HUMAN (see all proteins):
    ARHGAP23    ARHGEF1    NET1    ARHGEF11

    ARHGEF12 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/2385 NCBI SNPs in ARHGEF12 are shown (see all 2385    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 11 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs730087181,2
    --116146847(+) TTTTTC/TCCCCC 2 -- us2k10--------
    rs38407621,2
    C,--116147627(-) CCCCCC/-TTGTC 2 -- us2k11Minor allele frequency- -:0.50CSA 2
    rs357348511,2
    C,F,H,--116147737(+) CGAAGG/AGGCAT 2 -- us2k15Minor allele frequency- A:0.01EA NS NA 680
    rs1129881751,2
    C,--116147851(+) CCAAAA/C/GCGGGC 2 -- us2k10--------
    rs735802051,2
    C,F,--116148547(+) CGAGGC/GCCCGA 2 -- us2k11Minor allele frequency- G:0.05WA 118
    rs1149384041,2
    C,F,--116149725(+) TGTTGC/TATGGT 2 -- int11Minor allele frequency- T:0.04WA 118
    rs122707711,2
    F,--116150803(+) TAATGT/GTTTTT 2 -- int11Minor allele frequency- G:0.06WA 118
    rs122708281,2
    F,--116150889(+) AGCACT/AGCTGA 2 -- int11Minor allele frequency- A:0.11WA 118
    rs569797701,2
    C--116153025(+) AGTGCTGGGATTACAGGCTTGAGCC
    ATCGGCCTCCCAAAGTGC
    /-
    CGGGA
    2 -- int11Minor allele frequency- -:0.50NA 2
    rs125748651,2
    C,H--116153602(+) TTCTTC/TTGAGT 2 -- int11Minor allele frequency- T:0.00NA 2

    HapMap Linkage Disequilibrium report for ARHGEF12 (120207787 - 120360645 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 8 variations for ARHGEF12
         8 Indels: 86059 75832 60066 86058 75831 86060 86056 86057
    Human Gene Mutation Database (HGMD): ARHGEF12

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ARHGEF12
    DNA2.0 Custom Variant and Variant Library Synthesis for ARHGEF12

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    ARHGEF12 for disorders           About GeneDecksing

    OMIM gene information: 604763   
    OMIM disorders: 601626  
    UniProtKB/Swiss-Prot: ARHGC_HUMAN, Q9NZN5
  • Note=A chromosomal aberration involving ARHGEF12 may be a cause of acute leukemia. Translocation
  • t(11;11)(q23;23) with MLL

    17 diseases for ARHGEF12:    About MalaCards
    acute myeloid leukemia    leukemia    myeloid leukemia    shwachman-diamond syndrome
    squamous cell carcinoma    prostate cancer    spasticity    colorectal cancer
    prostatitis    cholesterol    tuberculosis    carcinoma
    neuronitis    breast and colorectal cancer    breast cancer    adenocarcinoma
    pancreatitis

    1 disease from the University of Copenhagen DISEASES database for ARHGEF12:
    Vascular disease

    3 Novoseek disease relationships for ARHGEF12 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    leukemia 19 6 11373293 (2), 15276214 (1), 19560536 (1)
    prostate cancer 0 1 15143072 (1)
    cancer 0 1 11373293 (1)

    Human Genome Epidemiology (HuGE) Navigator: ARHGEF12 (7 documents)

    Export disorders for ARHGEF12 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for ARHGEF12 gene, integrated from 9 sources (see all 73):
    (articles sorted by number of sources associating them with ARHGEF12)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Identification of a gene at 11q23 encoding a guanine nucleotide exchange factor: evidence for its fusion with MLL in acute myeloid leukemia. (PubMed id 10681437)1, 2, 3 Kourlas P.J....Caligiuri M.A. (2000)
    2. Prediction of the coding sequences of unidentified human genes. VII. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro. (PubMed id 9205841)1, 2, 3 Nagase T.... Ohara O. (1997)
    3. Direct interaction of insulin-like growth factor-1 receptor with leukemia-associated RhoGEF. (PubMed id 11724822)1, 2, 9 Taya S.... Kaibuchi K. (2001)
    4. Plexin B regulates Rho through the guanine nucleotide exchange factors leukemia-associated Rho GEF (LARG) and PDZ-RhoGEF. (PubMed id 12183458)1, 2, 9 Perrot V.... Gutkind J.S. (2002)
    5. Structural determinants of RhoA binding and nucleotide exchange in leukemia-associated Rho guanine-nucleotide exchange factor. (PubMed id 15331592)1, 2, 9 Kristelly R....Tesmer J.J. (2004)
    6. Conformational change upon ligand binding and dynamics of the PDZ domain from leukemia-associated Rho guanine nucleotide exchange factor. (PubMed id 18411422)1, 2, 9 Liu J....Shi Y. (2008)
    7. B plexins activate Rho through PDZ-RhoGEF. (PubMed id 12372594)1, 2 Driessens M.H.E.... Collard J.G. (2002)
    8. Leukemia-associated Rho guanine nucleotide exchange factor (LARG) links heterotrimeric G proteins of the G(12) family to Rho. (PubMed id 11094164)1, 2 Fukuhara S.... Gutkind J.S. (2000)
    9. Leukemia-associated Rho guanine nucleotide exchange factor, a Dbl family protein found mutated in leukemia, causes transformation by activation of RhoA. (PubMed id 11373293)1, 9 Reuther G.W....Der C.J. (2001)
    10. Genetic variants in the leukemia-associated Rho guanine nucleotide exchange factor (ARHGEF12) gene are not associated with T2DM and related parameters in Caucasians (KORA study). (PubMed id 17766704)1, 9 Holzapfel C....Illig T. (2007)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 23365 HGNC: 14193 AceView: ARHGEF12 Ensembl:ENSG00000196914 euGenes: HUgn23365
    ECgene: ARHGEF12 Kegg: 23365 H-InvDB: ARHGEF12

    (According to HUGE)
    About This Section
    HUGE: KIAA0382

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for ARHGEF12 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for ARHGEF12 Genetics and Cytogenetics in Oncology and Haematology

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for ARHGEF12 gene:
    Search GeneIP for patents involving ARHGEF12

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Antibodies for ARHGEF12 (LARG)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for ARHGEF12  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ARHGEF12   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ARHGEF12  
     Browse OriGene Protein Over-expression Lysates   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for ARHGEF12   OriGene 3'-UTR Clone for ARHGEF12  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ARHGEF12   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ARHGEF12  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ARHGEF12   OriGene Custom Protein Services for ARHGEF12  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ARHGEF12
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ARHGEF12
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ARHGEF12
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ARHGEF12
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ARHGEF12
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ARHGEF12
     GenScript Custom Purified and Recombinant Proteins Services for ARHGEF12 GenScript cDNA clones with any tag delivered in your preferred vector for ARHGEF12
     GenScript Custom Assay Services for ARHGEF12 GenScript Custom Superior Antibodies Services for ARHGEF12
     GenScript Custom overexpressing Cell Line Services for ARHGEF12 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in ARHGEF12 promoter
     Search Chromatin IP Primers for ARHGEF12
     RT2 qPCR Primer Assay in human, mouse, rat ARHGEF12
     GNC Network for ARHGEF12
     SABiosciences PCR Arrays including human, mouse, rat ARHGEF12
     Search Tocris compounds for ARHGEF12
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     ARHGEF12 antibodies
     ARHGEF12 proteins
     ARHGEF12 lysates
     Search for Antibodies for ARHGEF12 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for ARHGEF12
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     ARHGEF12 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for ARHGEF12
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ARHGEF12
     Browse SwitchGear 3'UTR luciferase reporter plasmids for ARHGEF12
     SwitchGear Promoter luciferase reporter plasmids for ARHGEF12
     Search ThermoFisher Antibodies for ARHGEF12
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ARHGEF12
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ARHGEF12 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4