Free for academic non-profit institutions. Other users need a Commercial license

Aliases for AP5Z1 Gene

Aliases for AP5Z1 Gene

  • Adaptor Related Protein Complex 5 Zeta 1 Subunit 2 3 5
  • KIAA0415 2 3 4
  • Adaptor-Related Protein Complex 5 Zeta Subunit 3 4
  • Zeta5 3 4
  • SPG48 3 4
  • Adaptor-Related Protein Complex 5, Zeta 1 Subunit 2
  • Adapter-Related Protein Complex 5 Zeta Subunit 3
  • AP-5 Complex Subunit Zeta-1 3
  • Zeta 3

External Ids for AP5Z1 Gene

Previous HGNC Symbols for AP5Z1 Gene

  • KIAA0415

Previous GeneCards Identifiers for AP5Z1 Gene

  • GC07P004816
  • GC07P004738

Summaries for AP5Z1 Gene

Entrez Gene Summary for AP5Z1 Gene

  • This gene was identified by genome-wide screen for genes involved in homologous recombination DNA double-strand break repair (HR-DSBR). The encoded protein was found in a complex with other proteins that have a role in HR-DSBR. Knockdown of this gene reduced homologous recombination, and mutations in this gene were found in patients with spastic paraplegia. It was concluded that this gene likely encodes a helicase (PMID:20613862). [provided by RefSeq, Jan 2011]

GeneCards Summary for AP5Z1 Gene

AP5Z1 (Adaptor Related Protein Complex 5 Zeta 1 Subunit) is a Protein Coding gene. Diseases associated with AP5Z1 include Spastic Paraplegia 48, Autosomal Recessive and Spastic Paraplegia 48. GO annotations related to this gene include transcription factor activity, sequence-specific DNA binding and sequence-specific DNA binding.

UniProtKB/Swiss-Prot for AP5Z1 Gene

  • As part of AP-5, a probable fifth adaptor protein complex it may be involved in endosomal transport. According to PubMed:20613862 it is a putative helicase required for efficient homologous recombination DNA double-strand break repair.

Additional gene information for AP5Z1 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AP5Z1 Gene

Genomics for AP5Z1 Gene

Regulatory Elements for AP5Z1 Gene

Enhancers for AP5Z1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH07H005591 1.8 FANTOM5 ENCODE dbSUPER 30.1 +819.8 819831 8 HDGF PKNOX1 ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF766 CBX5 C7orf26 USP42 AP5Z1 TNRC18 RNF216P1 RPL22P16 ANKRD61 CCZ1 RBAK RNF216
GH07H005523 1.8 FANTOM5 ENCODE dbSUPER 28.1 +753.9 753876 11 HNRNPUL1 HDGF PKNOX1 MLX ARNT ARID4B SIN3A FEZF1 DMAP1 ZNF2 USP42 ANKRD61 RNF216 AP5Z1 CCZ1 RBAK RNF216P1 TNRC18 FBXL18 WIPI2
GH07H004619 1.2 Ensembl ENCODE 37.4 -154.7 -154702 2 HDGF PKNOX1 ZFP64 ATF7 ZC3H11A NCOA1 REST ZNF623 ZNF518A SMARCA4 AP5Z1 RNF216P1 RBAK TNRC18 GC07P004617 FOXK1
GH07H005551 2 FANTOM5 Ensembl ENCODE dbSUPER 22.4 +780.2 780155 7 HDGF PKNOX1 ARNT ZFP64 ARID4B SIN3A FEZF1 DMAP1 ZNF2 ZBTB7B AP5Z1 ANKRD61 TNRC18 USP42 ZNF890P EIF2AK1 CCZ1 ACTB WIPI2 ENSG00000272719
GH07H005456 1.5 Ensembl ENCODE dbSUPER 25.2 +682.3 682252 1 PKNOX1 ATF1 ARNT TCF12 GTF3C2 ZNF766 GATA2 ELK1 ATF7 NCOA1 USP42 ANKRD61 AP5Z1 TNRC18 RNF216P1 RNF216 PMS2 GC07P005444 ENSG00000230733
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around AP5Z1 on UCSC Golden Path with GeneCards custom track

Promoters for AP5Z1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000208024 78 1801 PKNOX1 ARID4B SIN3A FEZF1 DMAP1 ZNF2 ZBTB7B YY1 ZNF766 ZNF143

Genomic Location for AP5Z1 Gene

Chromosome:
7
Start:
4,775,622 bp from pter
End:
4,794,395 bp from pter
Size:
18,774 bases
Orientation:
Plus strand

Genomic View for AP5Z1 Gene

Genes around AP5Z1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AP5Z1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AP5Z1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for AP5Z1 Gene

Proteins for AP5Z1 Gene

  • Protein details for AP5Z1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O43299-AP5Z1_HUMAN
    Recommended name:
    AP-5 complex subunit zeta-1
    Protein Accession:
    O43299
    Secondary Accessions:
    • Q8N3X2
    • Q96H80

    Protein attributes for AP5Z1 Gene

    Size:
    807 amino acids
    Molecular mass:
    88605 Da
    Quaternary structure:
    • Probably part of the adaptor protein complex 5 (AP-5) a tetramer composed of AP5B1, AP5M1, AP5S1 and AP5Z1. Interacts with ZFYVE26 and SPG11.
    SequenceCaution:
    • Sequence=BAA24845.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Alternative splice isoforms for AP5Z1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for AP5Z1 Gene

Post-translational modifications for AP5Z1 Gene

  • Ubiquitination at Lys30 and Lys178
  • Modification sites at PhosphoSitePlus

Other Protein References for AP5Z1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for AP5Z1 Gene

Domains & Families for AP5Z1 Gene

Gene Families for AP5Z1 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for AP5Z1 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for AP5Z1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with AP5Z1: view

No data available for UniProtKB/Swiss-Prot for AP5Z1 Gene

Function for AP5Z1 Gene

Molecular function for AP5Z1 Gene

UniProtKB/Swiss-Prot Function:
As part of AP-5, a probable fifth adaptor protein complex it may be involved in endosomal transport. According to PubMed:20613862 it is a putative helicase required for efficient homologous recombination DNA double-strand break repair.

Phenotypes From GWAS Catalog for AP5Z1 Gene

Gene Ontology (GO) - Molecular Function for AP5Z1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 20613862
genes like me logo Genes that share ontologies with AP5Z1: view
genes like me logo Genes that share phenotypes with AP5Z1: view

Human Phenotype Ontology for AP5Z1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for AP5Z1
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for AP5Z1 Gene

Localization for AP5Z1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for AP5Z1 Gene

Cytoplasm. Nucleus. Note=By SDS-PAGE, 2 isoforms have been observed, the shorter seems to be predominantly nuclear and the longer is mostly cytoplasmic. {ECO:0000269 PubMed:20613862}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for AP5Z1 gene
Compartment Confidence
nucleus 5
cytosol 2
peroxisome 1
lysosome 1
endosome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nuclear speckles (3)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for AP5Z1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA,IEA 20613862
GO:0005654 nucleoplasm IDA --
GO:0005737 cytoplasm IEA,IDA 20613862
GO:0016607 nuclear speck IDA --
GO:0030119 AP-type membrane coat adaptor complex NAS 22022230
genes like me logo Genes that share ontologies with AP5Z1: view

Pathways & Interactions for AP5Z1 Gene

SuperPathways for AP5Z1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for AP5Z1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000724 double-strand break repair via homologous recombination IMP 20613862
GO:0006281 DNA repair IEA --
GO:0006810 transport IEA --
GO:0006974 cellular response to DNA damage stimulus IEA --
GO:0015031 protein transport IEA --
genes like me logo Genes that share ontologies with AP5Z1: view

No data available for Pathways by source and SIGNOR curated interactions for AP5Z1 Gene

Drugs & Compounds for AP5Z1 Gene

No Compound Related Data Available

Transcripts for AP5Z1 Gene

Unigene Clusters for AP5Z1 Gene

Adaptor-related protein complex 5, zeta 1 subunit:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for AP5Z1
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for AP5Z1 Gene

No ASD Table

Relevant External Links for AP5Z1 Gene

GeneLoc Exon Structure for
AP5Z1
ECgene alternative splicing isoforms for
AP5Z1

Expression for AP5Z1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for AP5Z1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for AP5Z1 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (9.0) and Bone (7.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for AP5Z1 Gene



Protein tissue co-expression partners for AP5Z1 Gene

NURSA nuclear receptor signaling pathways regulating expression of AP5Z1 Gene:

AP5Z1

SOURCE GeneReport for Unigene cluster for AP5Z1 Gene:

Hs.558440

Evidence on tissue expression from TISSUES for AP5Z1 Gene

  • Nervous system(4.3)

Phenotype-based relationships between genes and organs from Gene ORGANizer for AP5Z1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • nervous
  • skeletal muscle
  • skeleton
  • urinary
Organs:
Head and neck:
  • brain
  • head
Pelvis:
  • prostate
  • urinary bladder
Limb:
  • lower limb
General:
  • peripheral nerve
  • peripheral nervous system
  • spinal cord
genes like me logo Genes that share expression patterns with AP5Z1: view

Primer Products

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for AP5Z1 Gene

Orthologs for AP5Z1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for AP5Z1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia AP5Z1 33 34
  • 99.09 (n)
dog
(Canis familiaris)
Mammalia AP5Z1 33 34
  • 81.41 (n)
mouse
(Mus musculus)
Mammalia Ap5z1 33 16 34
  • 79.65 (n)
cow
(Bos Taurus)
Mammalia KIAA0415 33 34
  • 79.52 (n)
rat
(Rattus norvegicus)
Mammalia Ap5z1 33
  • 79.45 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 71 (a)
OneToMany
-- 34
  • 70 (a)
OneToMany
oppossum
(Monodelphis domestica)
Mammalia AP5Z1 34
  • 69 (a)
OneToOne
chicken
(Gallus gallus)
Aves AP5Z1 33 34
  • 65.55 (n)
lizard
(Anolis carolinensis)
Reptilia AP5Z1 34
  • 61 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100497560 33
  • 61.93 (n)
zebrafish
(Danio rerio)
Actinopterygii LOC100537934 33
  • 59.93 (n)
ap5z1 34
  • 53 (a)
OneToOne
thale cress
(Arabidopsis thaliana)
eudicotyledons AT3G15160 33
  • 38.57 (n)
rice
(Oryza sativa)
Liliopsida Os04g0626900 33
  • 39.35 (n)
Species where no ortholog for AP5Z1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for AP5Z1 Gene

ENSEMBL:
Gene Tree for AP5Z1 (if available)
TreeFam:
Gene Tree for AP5Z1 (if available)

Paralogs for AP5Z1 Gene

(1) SIMAP similar genes for AP5Z1 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with AP5Z1: view

No data available for Paralogs for AP5Z1 Gene

Variants for AP5Z1 Gene

Sequence variations from dbSNP and Humsavar for AP5Z1 Gene

SNP ID Clin Chr 07 pos Sequence Context AA Info Type
rs1057519342 Pathogenic 4,789,856(+) TCAAC(C/T)AGCTG nc-transcript-variant, upstream-variant-2KB, reference, stop-gained
rs373919408 Pathogenic 4,787,644(+) GGCCT(A/G)GAACA nc-transcript-variant, reference, stop-gained
rs397704705 Pathogenic 4,781,213(+) TTCCC(GGAT/TGCTGTAAACTGTAACTGTAAA)CTGTA nc-transcript-variant, cds-indel, utr-variant-5-prime
rs397704709 Pathogenic 4,787,735(+) CTGCT(-/GGACCTGCCCTGCT)TGACG nc-transcript-variant, reference, frameshift-variant
rs761451474 Pathogenic 4,783,793(+) GGGCC(C/T)GGCAG nc-transcript-variant, reference, missense

Structural Variations from Database of Genomic Variants (DGV) for AP5Z1 Gene

Variant ID Type Subtype PubMed ID
esv2664593 CNV deletion 23128226
esv2733903 CNV deletion 23290073
esv3611949 CNV loss 21293372
nsv1029123 CNV loss 25217958
nsv471293 CNV loss 18288195
nsv481499 CNV novel sequence insertion 20440878
nsv482101 CNV gain 20164927
nsv528748 CNV loss 19592680
nsv5626 CNV insertion 18451855
nsv605977 CNV loss 21841781
nsv605978 CNV gain 21841781
nsv8033 CNV loss 18304495
nsv823994 CNV gain 20364138
nsv950797 CNV deletion 24416366

Variation tolerance for AP5Z1 Gene

Residual Variation Intolerance Score: 79.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.41; 77.14% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for AP5Z1 Gene

Human Gene Mutation Database (HGMD)
AP5Z1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
AP5Z1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AP5Z1 Gene

Disorders for AP5Z1 Gene

MalaCards: The human disease database

(25) MalaCards diseases for AP5Z1 Gene - From: HGMD, OMIM, ClinVar, GeneTests, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
spastic paraplegia 48, autosomal recessive
  • hereditary spastic paraplegia 48
spastic paraplegia 48
spastic paraplegia 35, autosomal recessive
  • hereditary spastic paraplegia 35
spastic paraplegia 54, autosomal recessive
  • hereditary spastic paraplegia 54
spastic paraplegia 47, autosomal recessive
  • hereditary spastic paraplegia 47
- elite association - COSMIC cancer census association via MalaCards
Search AP5Z1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

AP5Z1_HUMAN
  • Spastic paraplegia 48, autosomal recessive (SPG48) [MIM:613647]: A form of spastic paraplegia, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. {ECO:0000269 PubMed:20613862}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for AP5Z1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
AP5Z1
genes like me logo Genes that share disorders with AP5Z1: view

No data available for Genatlas for AP5Z1 Gene

Publications for AP5Z1 Gene

  1. The fifth adaptor protein complex. (PMID: 22022230) Hirst J … Robinson MS (PLoS biology 2011) 2 3 4 60
  2. A genome-scale DNA repair RNAi screen identifies SPG48 as a novel gene associated with hereditary spastic paraplegia. (PMID: 20613862) Słabicki M … Buchholz F (PLoS biology 2010) 2 3 4 60
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 60
  4. The DNA sequence of human chromosome 7. (PMID: 12853948) Hillier LW … Wilson RK (Nature 2003) 3 4 60
  5. Prediction of the coding sequences of unidentified human genes. VIII. 78 new cDNA clones from brain which code for large proteins in vitro. (PMID: 9455477) Ishikawa K … Ohara O (DNA research : an international journal for rapid publication of reports on genes and genomes 1997) 3 4 60

Products for AP5Z1 Gene

Sources for AP5Z1 Gene

Content
Loading form....