Free for academic non-profit institutions. Other users need a Commercial license

Aliases for AP4B1 Gene

Aliases for AP4B1 Gene

  • Adaptor-Related Protein Complex 4, Beta 1 Subunit 2 3
  • AP-4 Adaptor Complex Subunit Beta 3 4
  • Beta 4 Subunit Of AP-4 2 3
  • Spastic Paraplegia 47 2 3
  • Beta4-Adaptin 3 4
  • Adaptor-Related Protein Complex 4 Subunit Beta-1 4
  • Beta Subunit Of AP-4 4
  • BETA-4 3
  • CPSQ5 3
  • SPG47 3

External Ids for AP4B1 Gene

Previous HGNC Symbols for AP4B1 Gene

  • SPG47

Previous GeneCards Identifiers for AP4B1 Gene

  • GC01M114851
  • GC01M113319
  • GC01M113537
  • GC01M113736
  • GC01M114149
  • GC01M114239
  • GC01M114437
  • GC01M112295

Summaries for AP4B1 Gene

Entrez Gene Summary for AP4B1 Gene

  • This gene encodes a subunit of a heterotetrameric adapter-like complex 4 that is involved in targeting proteins from the trans-Golgi network to the endosomal-lysosomal system. Mutations in this gene are associated with cerebral palsy spastic quadriplegic type 5 (CPSQ5) disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

GeneCards Summary for AP4B1 Gene

AP4B1 (Adaptor-Related Protein Complex 4, Beta 1 Subunit) is a Protein Coding gene. Diseases associated with AP4B1 include spastic paraplegia 47, autosomal recessive and spastic paraplegia 47. Among its related pathways are Lysosome and Vesicle-mediated transport. GO annotations related to this gene include binding and protein transporter activity. An important paralog of this gene is AP1B1.

UniProtKB/Swiss-Prot for AP4B1 Gene

  • Subunit of novel type of clathrin- or non-clathrin-associated protein coat involved in targeting proteins from the trans-Golgi network (TGN) to the endosomal-lysosomal system

Gene Wiki entry for AP4B1 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AP4B1 Gene

Genomics for AP4B1 Gene

Regulatory Elements for AP4B1 Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for AP4B1 Gene

113,894,748 bp from pter
113,905,206 bp from pter
10,459 bases
Minus strand

Genomic View for AP4B1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for AP4B1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for AP4B1 Gene

Proteins for AP4B1 Gene

  • Protein details for AP4B1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    AP-4 complex subunit beta-1
    Protein Accession:
    Secondary Accessions:
    • B7Z4X3
    • Q59EJ4
    • Q96CL6

    Protein attributes for AP4B1 Gene

    739 amino acids
    Molecular mass:
    83260 Da
    Quaternary structure:
    • Adaptor protein complex 4 (AP-4) is a heterotetramer composed of two large adaptins (epsilon-type subunit AP4E1 and beta-type subunit AP4B1), a medium adaptin (mu-type subunit AP4M1) and a small adaptin (sigma-type AP4S1). Interacts with ENTHD2; this interaction requires the presence of a functional AP-4 complex.
    • Sequence=BAD93054.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for AP4B1 Gene

    Alternative splice isoforms for AP4B1 Gene


neXtProt entry for AP4B1 Gene

Proteomics data for AP4B1 Gene at MOPED

Post-translational modifications for AP4B1 Gene

  • Ubiquitination at Lys 577
  • Modification sites at PhosphoSitePlus

Antibody Products

  • Santa Cruz Biotechnology (SCBT) Antibodies for AP4B1

No data available for DME Specific Peptides for AP4B1 Gene

Domains & Families for AP4B1 Gene

Suggested Antigen Peptide Sequences for AP4B1 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the adaptor complexes large subunit family.
  • Belongs to the adaptor complexes large subunit family.
genes like me logo Genes that share domains with AP4B1: view

No data available for Gene Families for AP4B1 Gene

Function for AP4B1 Gene

Molecular function for AP4B1 Gene

UniProtKB/Swiss-Prot Function:
Subunit of novel type of clathrin- or non-clathrin-associated protein coat involved in targeting proteins from the trans-Golgi network (TGN) to the endosomal-lysosomal system

Gene Ontology (GO) - Molecular Function for AP4B1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005215 transporter activity TAS 10066790
GO:0005488 binding --
GO:0005515 protein binding IPI 25416956
GO:0008565 protein transporter activity IEA --
genes like me logo Genes that share ontologies with AP4B1: view
genes like me logo Genes that share phenotypes with AP4B1: view

Animal Model Products

miRNA for AP4B1 Gene

miRTarBase miRNAs that target AP4B1

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for AP4B1

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for AP4B1 Gene

Localization for AP4B1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for AP4B1 Gene

Golgi apparatus, trans-Golgi network. Membrane, coated pit. Note=Associated with the trans-Golgi network. Found in soma and dendritic shafts of neuronal cells.

Subcellular locations from

Jensen Localization Image for AP4B1 Gene COMPARTMENTS Subcellular localization image for AP4B1 gene
Compartment Confidence
endosome 4
golgi apparatus 4

Gene Ontology (GO) - Cellular Components for AP4B1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005802 trans-Golgi network TAS 10066790
GO:0005905 coated pit IEA --
GO:0030117 membrane coat --
GO:0030131 clathrin adaptor complex IEA --
GO:0031904 endosome lumen TAS --
genes like me logo Genes that share ontologies with AP4B1: view

Pathways & Interactions for AP4B1 Gene

genes like me logo Genes that share pathways with AP4B1: view

Pathways by source for AP4B1 Gene

Gene Ontology (GO) - Biological Process for AP4B1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006886 intracellular protein transport IEA --
GO:0006892 post-Golgi vesicle-mediated transport TAS --
GO:0015031 protein transport --
GO:0016192 vesicle-mediated transport --
GO:0061024 membrane organization TAS --
genes like me logo Genes that share ontologies with AP4B1: view

No data available for SIGNOR curated interactions for AP4B1 Gene

Drugs & Compounds for AP4B1 Gene

No Compound Related Data Available

Transcripts for AP4B1 Gene

Unigene Clusters for AP4B1 Gene

Adaptor-related protein complex 4, beta 1 subunit:
Representative Sequences:

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for AP4B1

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for AP4B1 Gene

ExUns: 1a · 1b · 1c · 1d · 1e ^ 2a · 2b · 2c · 2d · 2e ^ 3a · 3b ^ 4a · 4b ^ 5a · 5b · 5c ^ 6a · 6b · 6c ^ 7a · 7b · 7c · 7d · 7e ^ 8 ^
SP1: - - -
SP2: - - - - - - - - -
SP3: - - - - - -
SP4: - - - - - - - - - -
SP5: - - - - -
SP6: - - - - - -
SP7: - - -
SP8: - - - - - - - -
SP9: - - - - - - - - - - -
SP10: - - - - -
SP11: - - - -
SP12: -
SP14: - - - - - - - - - - - -
SP20: - - - -

ExUns: 9a · 9b · 9c ^ 10a · 10b ^ 11a · 11b ^ 12 ^ 13a · 13b ^ 14a · 14b
SP1: - - - -
SP2: - - - -
SP4: - - -
SP12: - - -
SP13: - - -
SP17: -
SP18: -

Relevant External Links for AP4B1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for AP4B1 Gene

mRNA expression in normal human tissues for AP4B1 Gene

Protein differential expression in normal tissues from HIPED for AP4B1 Gene

This gene is overexpressed in Pancreas (36.5) and Breast (14.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for AP4B1 Gene

SOURCE GeneReport for Unigene cluster for AP4B1 Gene Hs.515048

mRNA Expression by UniProt/SwissProt for AP4B1 Gene

Tissue specificity: Widely expressed
genes like me logo Genes that share expression patterns with AP4B1: view

Protein tissue co-expression partners for AP4B1 Gene

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for AP4B1 Gene

Orthologs for AP4B1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for AP4B1 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia AP4B1 35
  • 91.06 (n)
  • 97.74 (a)
AP4B1 36
  • 93 (a)
(Canis familiaris)
Mammalia AP4B1 35
  • 90.83 (n)
  • 94.85 (a)
AP4B1 36
  • 78 (a)
(Mus musculus)
Mammalia Ap4b1 35
  • 87.35 (n)
  • 91.19 (a)
Ap4b1 16
Ap4b1 36
  • 91 (a)
(Pan troglodytes)
Mammalia AP4B1 35
  • 99.73 (n)
  • 99.73 (a)
AP4B1 36
  • 100 (a)
(Rattus norvegicus)
Mammalia Ap4b1 35
  • 87.69 (n)
  • 90.8 (a)
(Monodelphis domestica)
Mammalia AP4B1 36
  • 86 (a)
(Ornithorhynchus anatinus)
Mammalia AP4B1 36
  • 83 (a)
(Gallus gallus)
Aves AP4B1 35
  • 69.79 (n)
  • 74.48 (a)
AP4B1 36
  • 74 (a)
(Anolis carolinensis)
Reptilia AP4B1 36
  • 76 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ap4b1 35
  • 65.32 (n)
  • 68.29 (a)
(Danio rerio)
Actinopterygii ap4b1 35
  • 60.8 (n)
  • 59.22 (a)
zgc63878 35
ap4b1 36
  • 58 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes APL2 36
  • 20 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons AT5G11490 35
  • 48.1 (n)
  • 38.05 (a)
Species with no ortholog for AP4B1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for AP4B1 Gene

Gene Tree for AP4B1 (if available)
Gene Tree for AP4B1 (if available)

Paralogs for AP4B1 Gene

Paralogs for AP4B1 Gene

(3) SIMAP similar genes for AP4B1 Gene using alignment to 6 proteins:

genes like me logo Genes that share paralogs with AP4B1: view

Variants for AP4B1 Gene

Sequence variations from dbSNP and Humsavar for AP4B1 Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type MAF
VAR_030804 -
rs781664514 -- 113,902,838(+) CAGAC(-/CAGGGCACCATCTATAAAAAAGAACAAAGTTCTTAG)ATGTC cds-indel, intron-variant, utr-variant-5-prime, nc-transcript-variant
rs781295845 -- 113,902,702(+) GTCTT(C/T)GCACA reference, missense, utr-variant-5-prime, intron-variant, nc-transcript-variant
rs781214868 -- 113,902,608(+) GCCAT(C/T)TAGGA intron-variant
rs780801258 -- 113,902,051(+) TTCTG(G/T)TTTTT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for AP4B1 Gene

Variant ID Type Subtype PubMed ID
esv23869 CNV Loss 19812545
nsv819786 CNV Loss 19587683

Variation tolerance for AP4B1 Gene

Residual Variation Intolerance Score: 29.02% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 13.50; 95.53% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for AP4B1 Gene

HapMap Linkage Disequilibrium report
Human Gene Mutation Database (HGMD)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AP4B1 Gene

Disorders for AP4B1 Gene

MalaCards: The human disease database

(5) MalaCards diseases for AP4B1 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
spastic paraplegia 47, autosomal recessive
  • cerebral palsy, spastic quadriplegic 5
spastic paraplegia 47
  • spg47
severe intellectual disability and progressive spastic paraplegia
  • ap4 deficiency syndrome
cerebral palsy
  • mixed cerebral palsy
- elite association
Search AP4B1 in MalaCards View complete list of genes associated with diseases


  • Cerebral palsy, spastic quadriplegic 5 (CPSQ5) [MIM:614066]: A neurodevelopmental disorder characterized by neonatal hypotonia that progresses to hypertonia and spasticity, and severe mental retardation with poor or absent speech development. {ECO:0000269 PubMed:21620353}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for AP4B1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with AP4B1: view

No data available for Genatlas for AP4B1 Gene

Publications for AP4B1 Gene

  1. AP-4, a novel protein complex related to clathrin adaptors. (PMID: 10066790) Dell'Angelica E.C. … Bonifacino J.S. (J. Biol. Chem. 1999) 2 67
  2. An AP4B1 frameshift mutation in siblings with intellectual disability and spastic tetraplegia further delineates the AP-4 deficiency syndrome. (PMID: 24781758) Abdollahpour H. … Kutsche K. (Eur. J. Hum. Genet. 2015) 67
  3. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T. … Vidal M. (Cell 2014) 67
  4. Large-scale genotyping identifies 41 new loci associated with breast cancer risk. (PMID: 23535729) Michailidou K. … Easton D.F. (Nat. Genet. 2013) 67
  5. Multivariate proteomic profiling identifies novel accessory proteins of coated vesicles. (PMID: 22472443) Borner G.H. … Robinson M.S. (J. Cell Biol. 2012) 67

Products for AP4B1 Gene

Sources for AP4B1 Gene

Back to Top
