Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



ALDH1L1 Gene

protein-coding   GIFtS: 60
GCID: GC03M125822

Aldehyde Dehydrogenase 1 Family, Member L1

(Previous name: formyltetrahydrofolate dehydrogenase)
(Previous symbol: FTHFD)
  See ALDH1L1-related disease
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Aldehyde Dehydrogenase 1 Family, Member L11 2     Formyltetrahydrofolate Dehydrogenase1
FTHFD1 2 3 5     10-fTHF2
Cytosolic 10-Formyltetrahydrofolate Dehydrogenase1 2     10-Formyltetrahydrofolate Dehydrogenase2
10-FTHFDH2 3     EC 1.5.1.63
FDH2 3     Aldehyde Dehydrogenase Family 1 Member L13

External Ids:    HGNC: 39781   Entrez Gene: 108402   Ensembl: ENSG000001449087   OMIM: 6002495   UniProtKB: O758913   

Export aliases for ALDH1L1 gene to outside databases

Previous GC identifers: GC03M127306 GC03M123202


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for ALDH1L1 Gene:
The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine
dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein
belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with
decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that
overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript
variants. (provided by RefSeq, Jun 2012)

GeneCards Summary for ALDH1L1 Gene:
ALDH1L1 (aldehyde dehydrogenase 1 family, member L1) is a protein-coding gene. Diseases associated with ALDH1L1 include methanol poisoning. GO annotations related to this gene include formyltetrahydrofolate dehydrogenase activity and methyltransferase activity. An important paralog of this gene is ALDH1L2.

Gene Wiki entry for ALDH1L1 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000003.11  NT_005612.17  NC_018914.2  
Regulatory elements:
   Search for regulatory transcription factor binding sites for ALDH1L1
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidALDH1L1 promoter sequence
   Search Chromatin IP Primers for ALDH1L1

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ALDH1L1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 3q21.3   Ensembl cytogenetic band:  3q21.3   HGNC cytogenetic band: 3q21.2

ALDH1L1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ALDH1L1 gene location

GeneLoc information about chromosome 3         GeneLoc Exon Structure

GeneLoc location for GC03M125822:  view genomic region     (about GC identifiers)

Start:
125,822,408 bp from pter      End:
125,916,837 bp from pter
Size:
94,430 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, and/or antibodies-online,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: AL1L1_HUMAN, O75891 (See protein sequence)
Recommended Name: Cytosolic 10-formyltetrahydrofolate dehydrogenase  
Size: 902 amino acids; 98829 Da
3 PDB 3D structures from and Proteopedia for ALDH1L1:
2BW0 (3D)        2CFI (3D)        2CQ8 (3D)    
Secondary accessions: B4DG36 E9PBX3 Q68CS1
Alternative splicing: 3 isoforms:  O75891-1   O75891-2   O75891-3   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for ALDH1L1: NX_O75891

Explore proteomics data for ALDH1L1 at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See ALDH1L1 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (3 alternative transcripts): 
    NP_001257293.1  NP_001257294.1  NP_036322.2  

    ENSEMBL proteins: 
     ENSP00000273450   ENSP00000420293   ENSP00000395881   ENSP00000377083   ENSP00000419448  
     ENSP00000418905   ENSP00000418711   ENSP00000419826   ENSP00000419955   ENSP00000426594  
     ENSP00000426713   ENSP00000377081   ENSP00000414126  

    ALDH1L1 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for ALDH1L1
    OriGene Protein Over-expression Lysate for ALDH1L1
    OriGene MassSpec for ALDH1L1
    OriGene Custom Protein Services for ALDH1L1
    GenScript Custom Purified and Recombinant Proteins Services for ALDH1L1
    Novus Biologicals ALDH1L1 Protein
    Novus Biologicals ALDH1L1 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for ALDH1L1

     
    Search eBioscience for Proteins for ALDH1L1 

     
    antibodies-online proteins for ALDH1L1 (2 products) 

     
    antibodies-online peptides for ALDH1L1

    ALDH1L1 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for ALDH1L1
    OriGene Custom Antibody Services for ALDH1L1
    Novus Biologicals ALDH1L1 Antibodies
    Abcam antibodies for ALDH1L1
    Cloud-Clone Corp. Antibodies for ALDH1L1
    ThermoFisher Antibodies for ALDH1L1
    antibodies-online antibodies for ALDH1L1 (58 products) 

    ALDH1L1 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for ALDH1L1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ALDH1L1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for ALDH1L1
    Cloud-Clone Corp. CLIAs for ALDH1L1
    Search eBioscience for ELISAs for ALDH1L1 
    antibodies-online kits for ALDH1L1 (18 products) 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    ALDH: Aldehyde dehydrogenases

    Selected InterPro protein domains (see all 11):
     IPR005793 Formyl_trans_C
     IPR016163 Ald_DH_C
     IPR011034 Formyl_transferase_C-like
     IPR002376 Formyl_transf_N
     IPR001555 GART_AS

    Graphical View of Domain Structure for InterPro Entry O75891

    ProtoNet protein and cluster: O75891

    2 Blocks protein domains:
    IPB002086 Aldehyde dehydrogenase
    IPB005793 Formyl transferase


    UniProtKB/Swiss-Prot: AL1L1_HUMAN, O75891
    Similarity: In the N-terminal section; belongs to the GART family
    Similarity: In the C-terminal section; belongs to the aldehyde dehydrogenase family. ALDH1L subfamily
    Similarity: Contains 1 acyl carrier domain


    Find genes that share domains with ALDH1L1           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: AL1L1_HUMAN, O75891
    Catalytic activity: 10-formyltetrahydrofolate + NADP(+) + H(2)O = tetrahydrofolate + CO(2) + NADPH

         Enzyme Number (IUBMB): EC 1.5.1.61

         Gene Ontology (GO): Selected molecular function terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003824catalytic activity TAS10204077
    GO:0008168methyltransferase activity IEA--
    GO:0016155formyltetrahydrofolate dehydrogenase activity IEA--
    GO:0016491oxidoreductase activity ----
    GO:0016620oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor IEA--
         
    Find genes that share ontologies with ALDH1L1           About GenesLikeMe


    Phenotypes:
         1 GenomeRNAi human phenotype for ALDH1L1:
     Increased gamma-H2AX phosphory 

         1 MGI phenotypic allele for Aldh1l1 (no phenotypes)

    Find genes that share phenotypes with ALDH1L1           About GenesLikeMe

    Animal Models:
       genOway: Develop your customized and physiologically relevant rodent model for ALDH1L1

    miRNA
    Products:
        
    Block miRNA regulation of human, mouse, rat ALDH1L1 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate ALDH1L1
    SwitchGear 3'UTR luciferase reporter plasmidALDH1L1 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for ALDH1L1
    Predesigned siRNA for gene silencing in human, mouse, rat ALDH1L1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ALDH1L1

    Clone
    Products:
         
    OriGene clones in human, mouse for ALDH1L1 (see all 6)
    OriGene ORF clones in mouse, rat for ALDH1L1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: ALDH1L1 (NM_012190)
    Sino Biological Human cDNA Clone for ALDH1L1
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ALDH1L1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ALDH1L1

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ALDH1L1
    Browse ESI BIO Cell Lines and PureStem Progenitors for ALDH1L1 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ALDH1L1


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    AL1L1_HUMAN, O75891: Cytoplasm
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    cytosol3
    mitochondrion2
    nucleus2

    Gene Ontology (GO): 3 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005737cytoplasm ----
    GO:0005739mitochondrion IEA--
    GO:0070062extracellular vesicular exosome IDA19056867

    Find genes that share ontologies with ALDH1L1           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for ALDH1L1 About    
    See pathways by source

    SuperPathContained pathways About
    1One carbon pool by folate
    One carbon pool by folate0.53
    One Carbon Metabolism0.53
    2Folate-Alcohol and Cancer Pathway
    Folate-Alcohol and Cancer Pathway


    Find genes that share SuperPaths with ALDH1L1           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    2 BioSystems Pathways for ALDH1L1
        One Carbon Metabolism
    Folate-Alcohol and Cancer Pathway



    1 Kegg Pathway  (Kegg details for ALDH1L1):
        One carbon pool by folate

        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for ALDH1L1
    Interactions:

        Search GeneGlobe Interaction Network for ALDH1L1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for ALDH1L1 (O758913 ENSP000003770834) via UniProtKB, MINT, STRING, and/or I2D (see all 28)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SETQ011053I2D: score=1 
    YWHABP319463I2D: score=1 
    YWHAZP631043I2D: score=1 
    ACOT7ENSP000003670864STRING: ENSP00000367086
    AMTENSP000002735884STRING: ENSP00000273588
    About this table

    Gene Ontology (GO): 5 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006730one-carbon metabolic process IEA--
    GO:0008152metabolic process ----
    GO:0009058biosynthetic process IEA--
    GO:000925810-formyltetrahydrofolate catabolic process IEA--
    GO:0055114oxidation-reduction process ----

    Find genes that share ontologies with ALDH1L1           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for ALDH1L1 (AL1L1)

    6 HMDB Compounds for ALDH1L1    About this table
    CompoundSynonyms CAS #PubMed Ids
    Carbon dioxideCarbon oxide (see all 5)124-38-9--
    N10-Formyl-THF10-formyl-THF (see all 20)2800-34-2--
    NADPAdenine-nicotinamide dinucleotide phosphate (see all 18)53-59-8--
    NADPH2'-(dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) Adenosine 5'-ester with 1,4-dihydro-1-b-D-ribofuranosylnicotinamide (see all 23)53-57-6--
    Tetrahydrofolic acid(6S)-Tetrahydrofolate (see all 10)135-16-0--
    WaterDihydrogen oxide (see all 2)7732-18-5--

    1 DrugBank Compound for ALDH1L1    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    Tetrahydrofolic acid5,6,7,8-tetrahydrofolate (see all 3)135-16-0targetcofactor16627483 10585460 10395731 16712799 11320079

    3 Novoseek inferred chemical compound relationships for ALDH1L1 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    10-formyltetrahydrofolate 98.2 51 12684508 (5), 17057331 (3), 16014005 (2), 12351832 (2) (see all 21)
    tetrahydrofolate 90.7 11 10395731 (2), 16712799 (1), 18848533 (1), 11320079 (1) (see all 5)
    folate 73.2 4 16627483 (2), 8975761 (1), 19933275 (1)



    Find genes that share compounds with ALDH1L1           About GenesLikeMe



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for ALDH1L1 gene (3 alternative transcripts): 
    NM_001270364.1  NM_001270365.1  NM_012190.3  

    Unigene Cluster for ALDH1L1:

    Aldehyde dehydrogenase 1 family, member L1
    Hs.434435  [show with all ESTs]
    Unigene Representative Sequence: NM_012190
    18 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000273450 ENST00000472186 ENST00000467370(uc003ein.1) ENST00000452905
    ENST00000393434(uc003eim.1 uc010hse.1 uc011bki.1) ENST00000462808
    ENST00000476245(uc003eio.3) ENST00000473607(uc010hsf.1) ENST00000413612
    ENST00000484724(uc003eip.1 uc011bkj.1) ENST00000493803 ENST00000490367
    ENST00000460368 ENST00000488356 ENST00000509952 ENST00000511283 ENST00000393431
    ENST00000455064
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat ALDH1L1 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate ALDH1L1
    SwitchGear 3'UTR luciferase reporter plasmidALDH1L1 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for ALDH1L1
    Predesigned siRNA for gene silencing in human, mouse, rat ALDH1L1
    Clone
    Products:
         
    OriGene clones in human, mouse for ALDH1L1 (see all 6)
    OriGene ORF clones in mouse, rat for ALDH1L1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: ALDH1L1 (NM_012190)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ALDH1L1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ALDH1L1
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for ALDH1L1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ALDH1L1
      QuantiTect SYBR Green Assays in human, mouse, rat ALDH1L1
      QuantiFast Probe-based Assays in human, mouse, rat ALDH1L1

    Additional mRNA sequence: 

    AB209299.1 AF052732.1 AK222535.1 AK222694.1 AK294392.1 AK294530.1 AK307699.1 AK308112.1 
    BC027241.1 BC107041.2 CR749807.1 NR_072979.1 

    10 DOTS entries:

    DT.92420823  DT.100743169  DT.312589  DT.75100741  DT.99996687  DT.40296347  DT.95267790  DT.100786803 
    DT.120893471  DT.92420821 

    Selected AceView cDNA sequences (see all 130):

    BQ882944 CA313462 NM_012190 CR749807 BU734506 AI970775 NM_144776 BM669044 
    BQ636094 BM705315 BM694359 AL133015 CB155117 CB164663 BE855461 BC027241 
    AI380584 BU730516 BI829048 BX118891 AK124908 AL713273 AI273029 BX390138 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for ALDH1L1 (see all 12)    About this scheme

    ExUns: 1 ^ 2 ^ 3a · 3b · 3c · 3d · 3e · 3f ^ 4 ^ 5 ^ 6 ^ 7a · 7b · 7c ^ 8a · 8b · 8c ^ 9 ^ 10 ^ 11a · 11b ^ 12a · 12b ^ 13 ^ 14 ^ 15 ^
    SP1:                                            -     -           -                                         -                             -                     
    SP2:                                            -     -           -                                         -                             -                     
    SP3:                                                                                                        -                                                   
    SP4:                                            -     -           -     -     -     -                       -                                                   
    SP5:                                                                                                                                                            

    ExUns: 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23a · 23b ^ 24 ^ 25a · 25b ^ 26 ^ 27a · 27b · 27c ^ 28
    SP1:                                            -                 -                             -         
    SP2:              -                             -     -           -                             -         
    SP3:                                                                                                      
    SP4:                                                                                                      
    SP5:                                                              -                                       


    ECgene alternative splicing isoforms for ALDH1L1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    ALDH1L1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TCTGCATCTT
    ALDH1L1 Expression
    About this image


    ALDH1L1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 6) fully expand
     
     Neural Tube (Nervous System)    fully expand to see all 6 entries
             Metencephalon
     
     Brain (Nervous System)    fully expand to see all 5 entries
             Midbrain tegmentum
             Caudal astrospheres
     
     Kidney (Urinary System)    fully expand to see all 4 entries
             Distal Tubule Cells Distal Tubule
             Proximal Tubule
     
     Epithelial Cells
             Distal Tubule Cells Distal Tubule
     
     Adipose (Muscoskeletal System)
             HyStem+BMP4-induced 7SMOO32 cells
    ALDH1L1 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    ALDH1L1 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.434435

    UniProtKB/Swiss-Prot: AL1L1_HUMAN, O75891
    Tissue specificity: Highly expressed in liver, pancreas and kidney

        Custom PCR Arrays for ALDH1L1
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for ALDH1L1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ALDH1L1
    QuantiTect SYBR Green Assays in human, mouse, rat ALDH1L1
    QuantiFast Probe-based Assays in human, mouse, rat ALDH1L1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ALDH1L1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for ALDH1L1 gene from Selected species (see all 14)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Aldh1l11 , 5 aldehyde dehydrogenase 1 family, member L11, 5 86.99(n)1
    92.35(a)1
      6 (40.16 cM)5
    1077471  NM_027406.11  NP_081682.11 
     904864275 
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia aldh1l11 aldehyde dehydrogenase 1 family, member L1 72.58(n)
    77.94(a)
      496436  NM_001011027.1  NP_001011027.1 
    zebrafish
    (Danio rerio)
    Actinopterygii Dr.129712 Transcribed sequence with moderate similarity to protein more 80.09(n)    BI881099.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG86656
    --
    60(a)
    1 → many
    2L(21371227-21377995)
    worm
    (Caenorhabditis elegans)
    Secernentea alh-31 alh-3 58.09(n)
    60.4(a)
      177999  NM_069653.6  NP_502054.2 
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes ALD56
    ALD46
    (see all 3)
    Mitochondrial aldehyde dehydrogenase, involved in ...
    Mitochondrial aldehyde dehydrogenase, required for...
    (see all 3)
    46(a)
    43(a)
    (see all 3)
    many ↔ many
    many ↔ many
    (see all 3)
    V(304030-305592) YER073W
    XV(1039840-1041399) YOR374W


    ENSEMBL Gene Tree for ALDH1L1 (if available)
    TreeFam Gene Tree for ALDH1L1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for ALDH1L1 gene
    ALDH1L22  ALDH1A12  ENSG000002577672  ALDH1A22  ALDH1B12  ALDH7A12  ALDH6A12  ALDH22  
    ALDH8A12  ALDH9A12  ALDH1A32  
    8 SIMAP similar genes for ALDH1L1 using alignment to 9 protein entries:     AL1L1_HUMAN (see all proteins):
    DKFZp434O2417    ALDH1L2    ALDH1A1    ALDH1A2    ALDH1B1    ALDH1A3
    ALDH2    ALDH9A1

    Find genes that share paralogs with ALDH1L1           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for ALDH1L1 (see all 2086)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 3 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0361014
    A colorectal cancer sample4--see VAR_0361012 A V mis40--------
    rs38362591,2
    C--123211527(-) TCCCC-/CTTGGG 4 -- int10--------
    rs46467221,2
    C,F--123236551(-) TGTCT-/AG/GA 
            
    GAGTC
    4 -- int12CSA 4
    rs15843281,2
    C,F,A--123239047(+) ATGAGA/C/GCAAAG 4 -- int12NA 4
    rs15843291,2
    C,F,A,H--123239048(+) tgagaT/Caaagg 4 -- int112Minor allele frequency- C:0.33NS NA WA CSA EA 480
    rs1443889971,2
    C--123241543(+) ACCAA-/AACTCACTCATGGAGAAA
    CAGAAAATTTGAATAGATAT
    ATAAC
    4 -- int10--------
    rs64389811,2
    C,A--123261130(+) ATTTTT/ATTTTG 4 -- int13Minor allele frequency- A:0.00NA WA 6
    rs792300661,2
    C--123261130(+) ATTTT-/ATTTTG 4 -- int11Minor allele frequency- A:0.50CSA 2
    rs346042091,2
    C--123269236(+) GTCCTATC/-ATCAT 4 -- cds1 int11Minor allele frequency- -:0.00CSA 2
    rs2015046151,2
    --123272120(+) AGATA-/CCAAAC 4 -- int10--------

    HapMap Linkage Disequilibrium report for ALDH1L1 (125822408 - 125916837 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for ALDH1L1 (see all 23):    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2678139CNV Deletion23128226
    esv2725865CNV Deletion23290073
    esv2725864CNV Deletion23290073
    dgv5241n71CNV Loss21882294
    esv23981CNV Loss19812545
    nsv877411CNV Loss21882294
    nsv524971CNV Loss19592680
    dgv5240n71CNV Loss21882294
    dgv5239n71CNV Loss21882294
    dgv5244n71CNV Loss21882294

    Site Specific Mutation Identification with PCR Assays
    Search QIAGEN SeqTarget long-range PCR primers for resequencing ALDH1L1
    DNA2.0 Custom Variant and Variant Library Synthesis for ALDH1L1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 600249    OMIM disorders: --

    1 disease for ALDH1L1:    
    About MalaCards
    methanol poisoning


    Find genes that share disorders with ALDH1L1           About GenesLikeMe

    1 Novoseek inferred disease relationship for ALDH1L1 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    cancer 10.7 5 16014005 (2), 17525747 (1), 19147541 (1), 12805405 (1)

    Genetic Association Database (GAD): ALDH1L1
    Human Genome Epidemiology (HuGE) Navigator: ALDH1L1 (23 documents)

    Export disorders for ALDH1L1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for ALDH1L1 gene, integrated from 10 sources (see all 75):
    (articles sorted by number of sources associating them with ALDH1L1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Association of polymorphisms in one-carbon metabolism genes and postmenopausal breast cancer incidence. (PubMed id 17548676)1, 4, 9 Stevens V.L....Calle E.E. (amp 2007)
    2. A Large-scale genetic association study of esophageal adenocarcinoma risk. (PubMed id 20453000)1, 4 Liu C.Y....Christiani D.C. (Carcinogenesis 2010)
    3. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PubMed id 20877624)1, 4 Hendrickson S.L....O'Brien S.J. (PLoS ONE 2010)
    4. Association of genetic variants with hemorrhagic stroke in Japanese individuals. (PubMed id 20198315)1, 4 Yoshida T....Yamada Y. (Int. J. Mol. Med. 2010)
    5. Assessment of a polymorphism of SDK1 with hypertension in Japanese Individuals. (PubMed id 19851296)1, 4 Oguri M....Yamada Y. (Am. J. Hypertens. 2010)
    6. Genetic susceptibility to distinct bladder cancer subphenotypes. (PubMed id 19692168)1, 4 Guey L.T....Malats N. (Eur. Urol. 2010)
    7. Maternal genes and facial clefts in offspring: a comprehensive search for genetic associations in two population-based cleft studies from Scandinavia. (PubMed id 20634891)1, 4 Jugessur A....Murray J.C. (PLoS ONE 2010)
    8. Germline polymorphisms in the one-carbon metabolism pathway and DNA methylation in colorectal cancer. (PubMed id 19936946)1, 4 Hazra A....Ogino S. (amp 2010)
    9. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PubMed id 20628086)1, 4 Bailey S.D....Anand S. (Diabetes Care 2010)
    10. Genetic variants in one-carbon metabolism-related genes contribute to NSCLC prognosis in a Chinese population. (PubMed id 20737570)1, 4 Jin G....Shen H. (Cancer 2010)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 10840 HGNC: 3978 AceView: FTHFD Ensembl:ENSG00000144908 euGenes: HUgn10840
    ECgene: ALDH1L1 Kegg: 10840 H-InvDB: ALDH1L1

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for ALDH1L1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for ALDH1L1 gene:
    Search GeneIP for patents involving ALDH1L1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for ALDH1L1   OriGene RNAi products in human, mouse, rat for ALDH1L1  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for ALDH1L1  
     OriGene MassSpec for ALDH1L1   OriGene clones in human, mouse for ALDH1L1  
     OriGene qSTAR qPCR primer pairs in human, mouse for ALDH1L1   OriGene Purified Protein for ALDH1L1  
     OriGene ORF clones in mouse, rat for ALDH1L1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ALDH1L1   OriGene Custom Protein Services for ALDH1L1  

     
     
     Block miRNA regulation of human, mouse, rat ALDH1L1 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing ALDH1L1
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ALDH1L1 Predesigned siRNA for gene silencing in human, mouse, rat ALDH1L1
     QuantiFast Probe-based Assays in human, mouse, rat ALDH1L1 QuantiTect SYBR Green Assays in human, mouse, rat ALDH1L1
     Custom PCR Arrays for ALDH1L1 Search Chromatin IP Primers for ALDH1L1
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ALDH1L1  Search GeneGlobe Interaction Network for ALDH1L1
     Search Regulatory tfbs for ALDH1L1
     GenScript Custom Purified and Recombinant Proteins Services for ALDH1L1 GenScript cDNA clones with any tag delivered in your preferred vector for ALDH1L1
     GenScript Custom Assay Services for ALDH1L1 GenScript Custom overexpressing Cell Line Services for ALDH1L1
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for ALDH1L1 (AL1L1)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for ALDH1L1
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     ALDH1L1 antibodies
     ALDH1L1 proteins
     ALDH1L1 lysates
     Antibodies for ALDH1L1
     See all of Abcam's Antibodies, Kits and Proteins for ALDH1L1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for ALDH1L1
     Antibodies for ALDH1L1
     ELISAs for ALDH1L1
     CLIAs for ALDH1L1



     Browse ESI BIO Cell Lines and PureStem Progenitors for ALDH1L1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ALDH1L1
     SwitchGear 3'UTR luciferase reporter plasmids for ALDH1L1
     SwitchGear Promoter luciferase reporter plasmids for ALDH1L1
     ThermoFisher Antibodies for ALDH1L1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ALDH1L1
     Browse compounds at ApexBio
     Search Addgene for plasmids for ALDH1L1
      Search eBioscience for proteins for ALDH1L1
      Search eBioscience for elisas for ALDH1L1
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for ALDH1L1
     antibodies-online antibodies for ALDH1L1 (58 products)
     antibodies-online kits for ALDH1L1 (18 products)
     antibodies-online peptides for ALDH1L1
     antibodies-online proteins for ALDH1L1 (2 products)
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 7 Oct 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ALDH1L1 gene at Home site.
    Version: 3.12.258 10 Dec 2014
    hostname: 356980-web2.xennexinc.com index build: 128 solr: 1.4