Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

ALDH1L1 Gene

protein-coding   GIFtS: 61
GCID: GC03M125822

Aldehyde Dehydrogenase 1 Family, Member L1

(Previous name: formyltetrahydrofolate dehydrogenase)
(Previous symbol: FTHFD)
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Aldehyde Dehydrogenase 1 Family, Member L11 2     Formyltetrahydrofolate Dehydrogenase1
FTHFD1 2 3 5     10-fTHF2
Cytosolic 10-Formyltetrahydrofolate Dehydrogenase1 2     10-Formyltetrahydrofolate Dehydrogenase2
10-FTHFDH2 3     EC 1.5.1.63
FDH2 3     Aldehyde Dehydrogenase Family 1 Member L13

External Ids:    HGNC: 39781   Entrez Gene: 108402   Ensembl: ENSG000001449087   OMIM: 6002495   UniProtKB: O758913   

Export aliases for ALDH1L1 gene to outside databases

Previous GC identifers: GC03M127306 GC03M123202


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for ALDH1L1 Gene:
The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine
dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein
belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with
decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that
overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript
variants. (provided by RefSeq, Jun 2012)

GeneCards Summary for ALDH1L1 Gene: 
ALDH1L1 (aldehyde dehydrogenase 1 family, member L1) is a protein-coding gene. Diseases associated with ALDH1L1 include methanol poisoning, and pilocytic astrocytoma, and among its related super-pathways are One carbon pool by folate. GO annotations related to this gene include oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor and catalytic activity. An important paralog of this gene is ALDH1L2.

Gene Wiki entry for ALDH1L1 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000003.11  NC_018914.2  NT_005612.16  
Regulatory elements:
   Search SABiosciences Regulatory transcription factor binding sites for ALDH1L1
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidALDH1L1 promoter sequence
   Search SABiosciences Chromatin IP Primers for ALDH1L1

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ALDH1L1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 3q21.3   Ensembl cytogenetic band:  3q21.3   HGNC cytogenetic band: 3q21.2

ALDH1L1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ALDH1L1 gene location

GeneLoc information about chromosome 3         GeneLoc Exon Structure

GeneLoc location for GC03M125822:  view genomic region     (about GC identifiers)

Start:
125,822,408 bp from pter      End:
125,916,837 bp from pter
Size:
94,430 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: AL1L1_HUMAN, O75891 (See protein sequence)
Recommended Name: Cytosolic 10-formyltetrahydrofolate dehydrogenase  
Size: 902 amino acids; 98829 Da
Subcellular location: Cytoplasm
3 PDB 3D structures from and Proteopedia for ALDH1L1:
2BW0 (3D)        2CFI (3D)        2CQ8 (3D)    
Secondary accessions: B4DG36 E9PBX3 Q68CS1
Alternative splicing: 3 isoforms:  O75891-1   O75891-2   O75891-3   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for ALDH1L1: NX_O75891

Explore proteomics data for ALDH1L1 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_O75891

  • ALDH1L1 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    ALDH1L1 Protein Expression
    REFSEQ proteins (3 alternative transcripts): 
    NP_001257293.1  NP_001257294.1  NP_036322.2  

    ENSEMBL proteins: 
     ENSP00000273450   ENSP00000420293   ENSP00000395881   ENSP00000377083   ENSP00000419448  
     ENSP00000418905   ENSP00000418711   ENSP00000419826   ENSP00000419955   ENSP00000426594  
     ENSP00000426713   ENSP00000377081   ENSP00000414126  

    Human Recombinant Protein Products for ALDH1L1: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for ALDH1L1
    OriGene Protein Over-expression Lysate for ALDH1L1
    OriGene MassSpec for ALDH1L1 
    OriGene Custom Protein Services for ALDH1L1
    GenScript Custom Purified and Recombinant Proteins Services for ALDH1L1
    Novus Biologicals ALDH1L1 Protein
    Novus Biologicals ALDH1L1 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for ALDH1L1 

    Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005737cytoplasm ----
    GO:0005739mitochondrion IEA--

    ALDH1L1 for ontologies           About GeneDecksing



    ALDH1L1 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for ALDH1L1
    OriGene Custom Antibody Services for ALDH1L1
    GenScript Custom Superior Antibodies Services for ALDH1L1
    Novus Biologicals ALDH1L1 Antibodies
    Abcam antibodies for ALDH1L1
    Cloud-Clone Corp. Antibodies for ALDH1L1 
    ThermoFisher Antibodies for ALDH1L1
    LSBio Antibodies in human, mouse, rat for ALDH1L1 

    Assay Products for ALDH1L1: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for ALDH1L1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ALDH1L1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for ALDH1L1 
    Cloud-Clone Corp. CLIAs for ALDH1L1


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    HGNC Gene Families: 
    ALDH: Aldehyde dehydrogenases

    5/11 InterPro protein domains (see all 11):
     IPR001555 GART_AS
     IPR005793 Formyl_trans_C
     IPR016162 Ald_DH_N
     IPR016163 Ald_DH_C
     IPR011034 Formyl_transferase_C-like

    Graphical View of Domain Structure for InterPro Entry O75891

    ProtoNet protein and cluster: O75891

    2 Blocks protein domains:
    IPB002086 Aldehyde dehydrogenase
    IPB005793 Formyl transferase


    UniProtKB/Swiss-Prot: AL1L1_HUMAN, O75891
    Similarity: In the N-terminal section; belongs to the GART family
    Similarity: In the C-terminal section; belongs to the aldehyde dehydrogenase family. ALDH1L subfamily
    Similarity: Contains 1 acyl carrier domain


    ALDH1L1 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: AL1L1_HUMAN, O75891
    Catalytic activity: 10-formyltetrahydrofolate + NADP(+) + H(2)O = tetrahydrofolate + CO(2) + NADPH

         Enzyme Number (IUBMB): EC 1.5.1.61

         Gene Ontology (GO): 5/6 molecular function terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003824catalytic activity TAS10204077
    GO:0008168methyltransferase activity IEA--
    GO:0016155formyltetrahydrofolate dehydrogenase activity IEA--
    GO:0016491oxidoreductase activity ----
    GO:0016620oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor IEA--
         
    ALDH1L1 for ontologies           About GeneDecksing


    Phenotypes:
         1 GenomeRNAi human phenotype for ALDH1L1:
     Increased gamma-H2AX phosphory 

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for ALDH1L1 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for ALDH1L1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for ALDH1L1 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for ALDH1L1 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ALDH1L1
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate ALDH1L1
    SwitchGear 3'UTR luciferase reporter plasmidALDH1L1 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for ALDH1L1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ALDH1L1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ALDH1L1
    Sirion Biotech Customized adenovirus for overexpression of ALDH1L1

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for ALDH1L1 (see all 7)
    OriGene ORF clones in mouse, rat for ALDH1L1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: ALDH1L1 (NM_012190)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ALDH1L1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ALDH1L1
    Sirion Biotech Customized lentivirus for stable overexpression of ALDH1L1 
                         Customized lentivirus expression plasmids for stable overexpression of ALDH1L1 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ALDH1L1
    Search LifeMap BioReagents cell lines for ALDH1L1
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ALDH1L1


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for ALDH1L1 About                                                                                                See pathways by source

    SuperPathContained pathways About
    1One Carbon Metabolism
    One Carbon Metabolism0.53
    One carbon pool by folate0.53

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    1 BioSystems Pathway for ALDH1L1
        One Carbon Metabolism


    1         Kegg Pathway  (Kegg details for ALDH1L1):
        One carbon pool by folate


    ALDH1L1 for pathways           About GeneDecksing

    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for ALDH1L1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 19)

    5/22 Interacting proteins for ALDH1L1 (O758913 ENSP000003770834) via UniProtKB, MINT, STRING, and/or I2D (see all 22)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SETQ011053I2D: score=1 
    YWHABP319463I2D: score=1 
    YWHAZP631043I2D: score=1 
    AMTENSP000002735884STRING: ENSP00000273588
    DHFRENSP000003963084STRING: ENSP00000396308
    About this table

    Gene Ontology (GO): 5 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006730one-carbon metabolic process IEA--
    GO:0008152metabolic process ----
    GO:0009058biosynthetic process IEA--
    GO:000925810-formyltetrahydrofolate catabolic process IEA--
    GO:0055114oxidation-reduction process ----

    ALDH1L1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    ALDH1L1 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for ALDH1L1 (AL1L1)

    6 HMDB Compounds for ALDH1L1    About this table
    CompoundSynonyms CAS #PubMed Ids
    Carbon dioxideCarbon oxide (see all 5)124-38-9--
    N10-Formyl-THF10-formyl-THF (see all 20)2800-34-2--
    NADPAdenine-nicotinamide dinucleotide phosphate (see all 18)53-59-8--
    NADPH2'-(dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) Adenosine 5'-ester with 1,4-dihydro-1-b-D-ribofuranosylnicotinamide (see all 23)53-57-6--
    Tetrahydrofolic acid(6S)-Tetrahydrofolate (see all 10)135-16-0--
    WaterDihydrogen oxide (see all 2)7732-18-5--

    1 DrugBank Compound for ALDH1L1    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    Tetrahydrofolic acid5,6,7,8-tetrahydrofolate (see all 3)135-16-0targetcofactor16627483 10585460 10395731 16712799 11320079

    3 Novoseek inferred chemical compound relationships for ALDH1L1 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    10-formyltetrahydrofolate 98.2 51 12684508 (5), 17057331 (3), 16014005 (2), 12351832 (2) (see all 21)
    tetrahydrofolate 90.7 11 10395731 (2), 16712799 (1), 18848533 (1), 11320079 (1) (see all 5)
    folate 73.2 4 16627483 (2), 8975761 (1), 19933275 (1)

    Search CenterWatch for drugs/clinical trials and news about ALDH1L1 / AL1L1

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for ALDH1L1 gene (3 alternative transcripts): 
    NM_001270364.1  NM_001270365.1  NM_012190.3  

    Unigene Cluster for ALDH1L1:

    Aldehyde dehydrogenase 1 family, member L1
    Hs.434435  [show with all ESTs]
    Unigene Representative Sequence: NM_012190
    18 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000273450 ENST00000472186 ENST00000467370(uc003ein.1) ENST00000452905
    ENST00000393434(uc003eim.1 uc010hse.1 uc011bki.1) ENST00000462808
    ENST00000476245(uc003eio.3) ENST00000473607(uc010hsf.1) ENST00000413612
    ENST00000484724(uc003eip.1 uc011bkj.1) ENST00000493803 ENST00000490367
    ENST00000460368 ENST00000488356 ENST00000509952 ENST00000511283 ENST00000393431
    ENST00000455064
    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ALDH1L1
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate ALDH1L1
    SwitchGear 3'UTR luciferase reporter plasmidALDH1L1 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for ALDH1L1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ALDH1L1
    Clone
    Products:
         
    OriGene clones in human, mouse for ALDH1L1 (see all 7)
    OriGene ORF clones in mouse, rat for ALDH1L1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: ALDH1L1 (NM_012190)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ALDH1L1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ALDH1L1
    Sirion Biotech Customized lentivirus for stable overexpression of ALDH1L1 
                         Customized lentivirus expression plasmids for stable overexpression of ALDH1L1 
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for ALDH1L1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ALDH1L1
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ALDH1L1
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ALDH1L1

    Additional mRNA sequence: 

    AB209299.1 AF052732.1 AK222535.1 AK222694.1 AK294392.1 AK294530.1 AK307699.1 AK308112.1 
    BC027241.1 BC107041.2 CR749807.1 NR_072979.1 

    10 DOTS entries:

    DT.92420823  DT.100743169  DT.312589  DT.75100741  DT.99996687  DT.40296347  DT.95267790  DT.100786803 
    DT.120893471  DT.92420821 

    24/130 AceView cDNA sequences (see all 130):

    BC027241 BM669044 BE855461 BU730516 NM_012190 AL133015 CA313462 AI970775 
    BU734506 CB155117 BQ882944 AI380584 CR749807 BQ636094 CB164663 BM705315 
    BM694359 NM_144776 BU731255 BC045645 BG291350 BG707181 AA769864 BX642613 

    GeneLoc Exon Structure

    5/12 Alternative Splicing Database (ASD) splice patterns (SP) for ALDH1L1 (see all 12)    About this scheme

    ExUns: 1 ^ 2 ^ 3a · 3b · 3c · 3d · 3e · 3f ^ 4 ^ 5 ^ 6 ^ 7a · 7b · 7c ^ 8a · 8b · 8c ^ 9 ^ 10 ^ 11a · 11b ^ 12a · 12b ^ 13 ^ 14 ^ 15 ^
    SP1:                                            -     -           -                                         -                             -                     
    SP2:                                            -     -           -                                         -                             -                     
    SP3:                                                                                                        -                                                   
    SP4:                                            -     -           -     -     -     -                       -                                                   
    SP5:                                                                                                                                                            

    ExUns: 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23a · 23b ^ 24 ^ 25a · 25b ^ 26 ^ 27a · 27b · 27c ^ 28
    SP1:                                            -                 -                             -         
    SP2:              -                             -     -           -                             -         
    SP3:                                                                                                      
    SP4:                                                                                                      
    SP5:                                                              -                                       


    ECgene alternative splicing isoforms for ALDH1L1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    ALDH1L1 expression in normal human tissues (normalized intensities)      ALDH1L1 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TCTGCATCTT
    ALDH1L1 Expression
    About this image


    ALDH1L1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/9 selected tissues (see all 9) fully expand
     
     Brain (Nervous System)    fully expand to see all 18 entries
             Thalamus
             Septum   
     
     Neural Tube (Nervous System)    fully expand to see all 9 entries
             Telencephalon
             spinal cord/lateral wall/ventricular layer   
     
     Kidney (Urinary System)    fully expand to see all 5 entries
             Proximal Tubule Cells Proximal Tubule
             Proximal Tubule
             visceral organ/metanephros/renal medulla   
     
     Spinal Cord (Nervous System)    fully expand to see all 3 entries
             Dorsal Horn   
     
     Adipose (Muscoskeletal System)    fully expand to see all 2 entries
             HyStem+BMP4-induced 7SMOO32 cells
             Adipocyte   

    See ALDH1L1 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for ALDH1L1

    SOURCE GeneReport for Unigene cluster: Hs.434435

    UniProtKB/Swiss-Prot: AL1L1_HUMAN, O75891
    Tissue specificity: Highly expressed in liver, pancreas and kidney

        SABiosciences Custom PCR Arrays for ALDH1L1
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for ALDH1L1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ALDH1L1
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ALDH1L1
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ALDH1L1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ALDH1L1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for ALDH1L1 gene from 5/12 species (see all 12)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Aldh1l11 , 5 aldehyde dehydrogenase 1 family, member L11, 5 86.99(n)1
    92.35(a)1
      6 (40.16 cM)5
    1077471  NM_027406.11  NP_081682.11 
     904864275 
    zebrafish
    (Danio rerio)
    Actinopterygii Dr.129712 Transcribed sequence with moderate similarity to protein more 80.09(n)    BI881099.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG86656
    --
    60(a)
    1 → many
    2L(21371227-21377995)
    worm
    (Caenorhabditis elegans)
    Secernentea alh-31 Protein ALH-3 58.05(n)
    60.4(a)
      177999  NM_069653.5  NP_502054.2 
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes ALD56
    ALD46
    (see all 3)
    Mitochondrial aldehyde dehydrogenase, involved in ...
    Mitochondrial aldehyde dehydrogenase, required for...
    (see all 3)
    45(a)
    42(a)
    (see all 3)
    many ↔ many
    many ↔ many
    (see all 3)
    V(304030-305592)
    XV(1039840-1041399)


    ENSEMBL Gene Tree for ALDH1L1 (if available)
    TreeFam Gene Tree for ALDH1L1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for ALDH1L1 gene
    ALDH1L22  ALDH1A12  ENSG000002577672  ALDH1A22  ALDH1B12  ALDH7A12  ALDH6A12  ALDH22  
    ALDH8A12  ALDH9A12  ALDH1A32  
    8 SIMAP similar genes for ALDH1L1 using alignment to 9 protein entries:     AL1L1_HUMAN (see all proteins):
    DKFZp434O2417    ALDH1L2    ALDH1A1    ALDH1A2    ALDH1B1    ALDH2
    ALDH1A3    ALDH9A1

    ALDH1L1 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/2086 SNPs in ALDH1L1 are shown (see all 2086)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 3 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0361014
    A colorectal cancer sample4--see VAR_0361012 A V mis40--------
    rs38362591,2
    C--123211527(-) TCCCC-/CTTGGG 4 -- int10--------
    rs46467221,2
    C,F--123236551(-) TGTCT-/AG/GA 
            
    GAGTC
    4 -- int12CSA 4
    rs15843281,2
    C,F,A--123239047(+) ATGAGA/C/GCAAAG 4 -- int12NA 4
    rs15843291,2
    C,F,A,H--123239048(+) tgagaT/Caaagg 4 -- int112Minor allele frequency- C:0.33NS NA WA CSA EA 480
    rs1443889971,2
    C--123241543(+) ACCAA-/AACTCACTCATGGAGAAA
    CAGAAAATTTGAATAGATAT
    ATAAC
    4 -- int10--------
    rs64389811,2
    C,A--123261130(+) ATTTTT/ATTTTG 4 -- int13Minor allele frequency- A:0.00NA WA 6
    rs792300661,2
    C--123261130(+) ATTTT-/ATTTTG 4 -- int11Minor allele frequency- A:0.50CSA 2
    rs346042091,2
    C--123269236(+) GTCCTATC/-ATCAT 4 -- cds1 int11Minor allele frequency- -:0.00CSA 2
    rs2015046151,2
    --123272120(+) AGATA-/CCAAAC 4 -- int10--------

    HapMap Linkage Disequilibrium report for ALDH1L1 (125822408 - 125916837 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 10/23 variations for ALDH1L1 (see all 23):    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2678139CNV Deletion23128226
    esv2725865CNV Deletion23290073
    esv2725864CNV Deletion23290073
    dgv5241n71CNV Loss21882294
    esv23981CNV Loss19812545
    nsv877411CNV Loss21882294
    nsv524971CNV Loss19592680
    dgv5240n71CNV Loss21882294
    dgv5239n71CNV Loss21882294
    dgv5244n71CNV Loss21882294

    SABiosciences Cancer Mutation PCR Assays
    Search QIAGEN SeqTarget long-range PCR primers for resequencing ALDH1L1
    DNA2.0 Custom Variant and Variant Library Synthesis for ALDH1L1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 600249    OMIM disorders: --

    20/23 diseases for ALDH1L1 (see all 23):    About MalaCards
    methanol poisoning    pilocytic astrocytoma    hydrocephalus    hyperhomocysteinemia
    neural tube defects    follicular lymphoma    spina bifida    astrocytoma
    diffuse large b-cell lymphoma    b-cell lymphomas    esophageal adenocarcinoma    non-hodgkin lymphoma
    hodgkin's lymphoma    tuberculosis    schizophrenia    esophagitis
    colorectal cancer    adenocarcinoma    hepatocellular carcinoma    prostate cancer


    ALDH1L1 for disorders           About GeneDecksing

    1 Novoseek inferred disease relationship for ALDH1L1 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    cancer 10.7 5 16014005 (2), 17525747 (1), 19147541 (1), 12805405 (1)

    Genetic Association Database (GAD): ALDH1L1
    Human Genome Epidemiology (HuGE) Navigator: ALDH1L1 (23 documents)

    Export disorders for ALDH1L1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for ALDH1L1 gene, integrated from 9 sources (see all 74):
    (articles sorted by number of sources associating them with ALDH1L1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Association of polymorphisms in one-carbon metabolism genes and postmenopausal breast cancer incidence. (PubMed id 17548676)1, 4, 9 Stevens V.L....Calle E.E. (2007)
    2. A Large-scale genetic association study of esophageal adenocarcinoma risk. (PubMed id 20453000)1, 4 Liu C.Y....Christiani D.C. (2010)
    3. Genetic variants in nuclear-encoded mitochondrial gen es influence AIDS progression. (PubMed id 20877624)1, 4 Hendrickson S.L....O'Brien S.J. (2010)
    4. Association of genetic variants with hemorrhagic stro ke in Japanese individuals. (PubMed id 20198315)1, 4 Yoshida T....Yamada Y. (2010)
    5. Assessment of a polymorphism of SDK1 with hypertensio n in Japanese Individuals. (PubMed id 19851296)1, 4 Oguri M....Yamada Y. (2010)
    6. Genetic susceptibility to distinct bladder cancer sub phenotypes. (PubMed id 19692168)1, 4 Guey L.T....Malats N. (2010)
    7. Maternal genes and facial clefts in offspring: a comp rehensive search for genetic associations in two population-based cleft studies from Scandinavia. (PubMed id 20634891)1, 4 Jugessur A....Murray J.C. (2010)
    8. Germline polymorphisms in the one-carbon metabolism p athway and DNA methylation in colorectal cancer. (PubMed id 19936946)1, 4 Hazra A....Ogino S. (2010)
    9. Variation at the NFATC2 locus increases the risk of t hiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipr il and rosiglitazone Medication (DREAM) study. (PubMed id 20628086)1, 4 Bailey S.D....Anand S. (2010)
    10. Genetic variants in one-carbon metabolism-related gen es contribute to NSCLC prognosis in a Chinese population. (PubMed id 20737570)1, 4 Jin G....Shen H. (2010)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 10840 HGNC: 3978 AceView: FTHFD Ensembl:ENSG00000144908 euGenes: HUgn10840
    ECgene: ALDH1L1 Kegg: 10840 H-InvDB: ALDH1L1

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for ALDH1L1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for ALDH1L1 gene:
    Search GeneIP for patents involving ALDH1L1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for ALDH1L1   OriGene RNAi products in human, mouse, rat for ALDH1L1  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for ALDH1L1  
     OriGene MassSpec something-or-other for ALDH1L1   OriGene clones in human, mouse for ALDH1L1  
     OriGene qSTAR qPCR primer pairs in human, mouse for ALDH1L1   OriGene Purified Protein for ALDH1L1  
     OriGene ORF clones in mouse, rat for ALDH1L1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ALDH1L1   OriGene Custom Protein Services for ALDH1L1  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ALDH1L1
     QIAGEN SeqTarget long-range PCR primers for resequencing ALDH1L1
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ALDH1L1
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ALDH1L1
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ALDH1L1
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ALDH1L1
     GenScript Custom Purified and Recombinant Proteins Services for ALDH1L1 GenScript cDNA clones with any tag delivered in your preferred vector for ALDH1L1
     GenScript Custom Assay Services for ALDH1L1 GenScript Custom Superior Antibodies Services for ALDH1L1
     GenScript Custom overexpressing Cell Line Services for ALDH1L1 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Search Regulatory tfbs for ALDH1L1
     Search Chromatin IP Primers for ALDH1L1
     RT2 qPCR Primer Assay in human, mouse, rat ALDH1L1
     Search GNC Networks for ALDH1L1
     SABiosciences Custom PCR Arrays for ALDH1L1
     Search Tocris compounds for ALDH1L1 (AL1L1)
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     ALDH1L1 antibodies
     ALDH1L1 proteins
     ALDH1L1 lysates
     Antibodies for ALDH1L1
     See all of Abcam's Antibodies, Kits and Proteins for ALDH1L1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for ALDH1L1
     Antibodies for ALDH1L1
     ELISAs for ALDH1L1
     CLIAs for ALDH1L1
     Search LifeMap BioReagents cell lines for ALDH1L1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ALDH1L1
     SwitchGear 3'UTR luciferase reporter plasmids for ALDH1L1
     SwitchGear Promoter luciferase reporter plasmids for ALDH1L1
     ThermoFisher Antibodies for ALDH1L1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ALDH1L1
     inGenious Targeting Laboratory - Custom generated mouse model solutions for ALDH1L1
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for ALDH1L1
    Customized:
     lentivirus for stable overexpression of ALDH1L1
     lentivirus expression plasmids for stable overexpression of ALDH1L1
     adenovirus for overexpression of ALDH1L1
     LSBio Antibodies in human, mouse, rat for ALDH1L1
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 3 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ALDH1L1 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4