Aliases for ALAS1 Gene
Aliases for ALAS1 Gene
External Ids for ALAS1 Gene
- HGNC: 396
- Entrez Gene: 211
- Ensembl: ENSG00000023330
- OMIM: 125290
- UniProtKB: P13196
Previous HGNC Symbols for ALAS1 Gene
- ALAS3
- ALAS
Previous GeneCards Identifiers for ALAS1 Gene
- GC03P051324
- GC03P051484
- GC03P052088
- GC03P052190
- GC03P052207
Summaries for ALAS1 Gene
-
This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
GeneCards Summary for ALAS1 Gene
ALAS1 (5'-Aminolevulinate Synthase 1) is a Protein Coding gene. Diseases associated with ALAS1 include Anemia, Sideroblastic, 1 and Acute Porphyria. Among its related pathways are Organelle biogenesis and maintenance and Mitochondrial Gene Expression. Gene Ontology (GO) annotations related to this gene include pyridoxal phosphate binding and 5-aminolevulinate synthase activity. An important paralog of this gene is ALAS2.
Additional gene information for ALAS1 Gene
- Monarch Initiative
- Search for ALAS1 at DataMed
- Search for ALAS1 at HumanCyc
No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ALAS1 Gene
Genomics for ALAS1 Gene
GeneHancer (GH) Regulatory Elements for ALAS1 Gene
GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
---|---|---|---|---|---|---|---|---|---|---|
GH03I052194 | Promoter/Enhancer | 2.4 | EPDnew Ensembl ENCODE dbSUPER | 550.8 | -1.3 | -1265 | 5.4 | HDGF ZFP64 ARID4B SIN3A DMAP1 GLI4 ZNF2 ZNF48 POLR2B ZNF766 | ALAS1 GLYCTK PBRM1 NT5DC2 ALDOAP1 | |
GH03I052182 | Enhancer | 1 | FANTOM5 dbSUPER | 7.1 | -15.8 | -15775 | 0.4 | FOXA2 ZFP64 THRB RAD21 RARA YY1 CREM RXRA REST NR2F2 | POC1A ALAS1 ALDOAP1 | |
GH03I051962 | Promoter/Enhancer | 1.2 | EPDnew ENCODE dbSUPER | 4.1 | -234.3 | -234262 | 2.2 | POLR2A GLIS1 SIN3A EGR2 ZBTB17 | GC03P051963 PCBP4 ALAS1 GPR62 ENSG00000272762 | |
GH03I052085 | Enhancer | 0.4 | ENCODE | 4.1 | -112.0 | -112043 | 0.2 | IKZF1 EBF1 RUNX3 | ALAS1 LINC00696 POC1A | |
GH03I052185 | Enhancer | 0.4 | FANTOM5 | 1.7 | -12.0 | -12003 | 0.2 | POLR2A CBFA2T3 ZNF24 | POC1A DUSP7 GLYCTK WDR82 MIR135A1 GLYCTK-AS1 PCBP4 GPR62 ALAS1 ALDOAP1 |
Regulatory Element Products
Genomic Locations for ALAS1 Gene
- chr3:52,198,083-52,214,327
- (GRCh38/hg38)
- Size:
- 16,245 bases
- Orientation:
- Plus strand
- chr3:52,232,102-52,248,343
- (GRCh37/hg19)
Genomic View for ALAS1 Gene
- Cytogenetic band:
-
- 3p21.2 by Ensembl
- 3p21.2 by Entrez Gene
- 3p21.2 by HGNC


RefSeq DNA sequence for ALAS1 Gene
Proteins for ALAS1 Gene
-
Protein details for ALAS1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P13196-HEM1_HUMAN
- Recommended name:
- 5-aminolevulinate synthase, nonspecific, mitochondrial
- Protein Accession:
- P13196
Protein attributes for ALAS1 Gene
- Size:
- 640 amino acids
- Molecular mass:
- 70581 Da
- Cofactor:
- Name=pyridoxal 5-phosphate; Xref=ChEBI:CHEBI:597326;
- Quaternary structure:
-
- Homodimer.
- Miscellaneous:
-
- There are two delta-ALA synthases in vertebrates: an erythroid- specific form and one (housekeeping) which is expressed in all tissues.
- SequenceCaution:
-
- Sequence=CAA68506.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305};
Protein Expression for ALAS1 Gene
Selected DME Specific Peptides for ALAS1 Gene
- P13196:
-
- FSSCFVAND
- HLRELLQRSDP
- DEVHAVGLYG
- KDAALLF
- SLLFYAQ
- VWCSNDYL
- VHSMDGA
- VGLELKPHSSAEC
- GCVGGYIA
- LPKSVSTFQYD
- PTPHHTP
- GALESVR
- RVADAAKNTE
- VANDSTL
- CNFCRRP
- FFEKKIDEKK
- IFRHNDV
- PKIVAFE
- PLHFEVM
- GFIFTTSLPP
- PGCEIYSD
- DIISGTLGKA
- IYVQAIN
- YRVFKTVNR
- LLRIAPTPHH
- KQRPERVSHLLQD
- CPSHIIP
- GAGGTRNI
Post-translational modifications for ALAS1 Gene
- Ubiquitination at Lys539
Other Protein References for ALAS1 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for ALAS1
- Novus Biologicals Antibodies for ALAS1
-
Abcam antibodies for ALAS1
- Invitrogen Antibodies for ALAS1
- GeneTex ALAS1 antibody for ALAS1
-
Santa Cruz Biotechnology (SCBT) Antibodies for ALAS1
Protein Products
-
OriGene Purified Proteins for ALAS1
- Search Origene for MassSpec and Protein Over-expression Lysates for ALAS1
- Origene Custom Protein Services for ALAS1
- Search GeneTex for Proteins for ALAS1
-
Abcam proteins for ALAS1
Assay Products
Domains & Families for ALAS1 Gene
Gene Families for ALAS1 Gene
- Human Protein Atlas (HPA):
-
- Enzymes
- Plasma proteins
- Predicted intracellular proteins
Protein Domains for ALAS1 Gene
Suggested Antigen Peptide Sequences for ALAS1 Gene
- GenScript: Design optimal peptide antigens:
-
- cDNA FLJ53856, highly similar to 5-aminolevulinate synthase, nonspecific, mitochondrial (EC 2.3.1.37) (B4DDG9_HUMAN)
- Delta-aminolevulinate synthase 1 (HEM1_HUMAN)
- cDNA, FLJ92941, Homo sapiens aminolevulinate, delta-, synthase 1 (ALAS1), nuclear gene encoding mitochondrial protein, mRNA (Q5JAM2_HUMAN)
Graphical View of Domain Structure for InterPro Entry
P13196UniProtKB/Swiss-Prot:
HEM1_HUMAN :- Belongs to the class-II pyridoxal-phosphate-dependent aminotransferase family.
- Family:
-
- Belongs to the class-II pyridoxal-phosphate-dependent aminotransferase family.
Function for ALAS1 Gene
Molecular function for ALAS1 Gene
- GENATLAS Biochemistry:
- aminolevulinate,delta-,synthase 1,housekeeping gene,liver,mitochondrial,pyridoxal dependent,catalyzing the first step of porphyrin biosynthesis
- UniProtKB/Swiss-Prot CatalyticActivity:
- Succinyl-CoA + glycine = 5-aminolevulinate + CoA + CO(2).
Enzyme Numbers (IUBMB) for ALAS1 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0003870 | 5-aminolevulinate synthase activity | TAS | -- |
GO:0005515 | protein binding | IPI | 21516116 |
GO:0016740 | transferase activity | IEA | -- |
GO:0016746 | transferase activity, transferring acyl groups | IEA | -- |
GO:0030170 | pyridoxal phosphate binding | IEA | -- |
Phenotypes for ALAS1 Gene
- MGI mutant phenotypes for ALAS1:
- inferred from 1 alleles
- GenomeRNAi human phenotypes for ALAS1:
-
- Increased vaccinia virus (VACV) infection
- shRNA abundance <= 50%
- Mildly decreased CFP-tsO45G cell surface transport
- Decreased viability in esophageal squamous lineage
- Increased transferrin (TF) endocytosis
- Increased shRNA abundance (Z-score > 2)
- Decreased shRNA abundance (Z-score < -2)
- Decreased viability of wild-type and TP53 knockout cells
Animal Models for ALAS1 Gene
- MGI Knock Outs for ALAS1:
-
- Alas1 tm1.1Mym
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for ALAS1
-
-
ViGene Biosciences lentiviral particle packaged cDNA for ALAS1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for ALAS1 gene
- Search ViGene Biosciences for ALAS1
CRISPR Products
-
OriGene CRISPR knockouts for ALAS1
- genomics-online: gRNA clones - Search results for 122 available ALAS1 gene related products
- Overview of 122 available ALAS1 gene related products
- Applied Biological Materials CRISPR for ALAS1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for ALAS1
- GenScript: Design CRISPR guide RNA sequences for ALAS1
miRNA for ALAS1 Gene
- miRTarBase miRNAs that target ALAS1
miRNA Products
- Search ViGene Biosciences for ALAS1
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for ALAS1
- Browse OriGene Inhibitory RNA Products For ALAS1
- genomics-online: shRNA clones - Search results for 122 available ALAS1 gene related products
- Overview of 122 available ALAS1 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for ALAS1 gene
Clone Products
- Sino Biological Human cDNA Clone for ALAS1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for ALAS1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ALAS1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for ALAS1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for ALAS1
-
ViGene Biosciences adenoviral particle packaged cDNA for ALAS1 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for ALAS1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for ALAS1 gene
No data available for Phenotypes From GWAS Catalog , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for ALAS1 Gene
Localization for ALAS1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for ALAS1 Gene
- Mitochondrion matrix.
- Mitochondria (4)
- Nucleoplasm (3)
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005654 | nucleoplasm | IDA | -- |
GO:0005739 | mitochondrion | IDA,IEA | -- |
GO:0005759 | mitochondrial matrix | TAS | -- |
GO:0005829 | cytosol | IDA | -- |
Pathways & Interactions for ALAS1 Gene
Pathways by source for ALAS1 Gene
5 BioSystems pathways for ALAS1 Gene
10 Reactome pathways for ALAS1 Gene
3 KEGG pathways for ALAS1 Gene
UniProtKB/Swiss-Prot P13196-HEM1_HUMAN
- Pathway: Porphyrin-containing compound metabolism; protoporphyrin-IX biosynthesis; 5-aminolevulinate from glycine: step 1/1.
Interacting Proteins for ALAS1 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0006778 | porphyrin-containing compound metabolic process | IEA | -- |
GO:0006782 | protoporphyrinogen IX biosynthetic process | IEA | -- |
GO:0006783 | heme biosynthetic process | TAS | -- |
GO:0007005 | mitochondrion organization | TAS | -- |
GO:0008152 | metabolic process | IEA | -- |
No data available for SIGNOR curated interactions for ALAS1 Gene
Drugs & Compounds for ALAS1 Gene
Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
---|---|---|---|---|---|---|
Glycine | Approved, Vet_approved | Nutra | Full agonist, Agonist, Target | 254 | ||
Pyridoxal Phosphate | Approved, Investigational | Nutra | Target, Target, cofactor | 17 | ||
Aminolevulinic acid | Approved | Pharma | 170 | |||
Carbon dioxide | Approved, Investigational, Vet_approved | Pharma | 0 | |||
Succinyl-CoA | Experimental | Pharma | 0 |
Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs | |
---|---|---|---|---|---|---|
acetyl-coa |
|
72-89-9 |
|
|||
Formyl-CoA |
|
13131-49-2 |
|
|||
L-2-Amino-3-oxobutanoic acid |
|
|
Transcripts for ALAS1 Gene
mRNA/cDNA for ALAS1 Gene
- (7) REFSEQ mRNAs :
- (9) Additional mRNA sequences :
- (369) Selected AceView cDNA sequences:
- (6) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for ALAS1 Gene
CRISPR Products
-
OriGene CRISPR knockouts for ALAS1
- genomics-online: gRNA clones - Search results for 122 available ALAS1 gene related products
- Overview of 122 available ALAS1 gene related products
- Applied Biological Materials CRISPR for ALAS1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for ALAS1
- GenScript: Design CRISPR guide RNA sequences for ALAS1
miRNA Products
- Search ViGene Biosciences for ALAS1
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for ALAS1
- Browse OriGene Inhibitory RNA Products For ALAS1
- genomics-online: shRNA clones - Search results for 122 available ALAS1 gene related products
- Overview of 122 available ALAS1 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for ALAS1 gene
Clone Products
- Sino Biological Human cDNA Clone for ALAS1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for ALAS1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ALAS1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for ALAS1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
ExUns: | 1a | · | 1b | · | 1c | · | 1d | ^ | 2 | ^ | 3a | · | 3b | · | 3c | ^ | 4a | · | 4b | ^ | 5 | ^ | 6a | · | 6b | ^ | 7 | ^ | 8 | ^ | 9 | ^ | 10 | ^ | 11 | ^ | 12 | ^ | 13a | · | 13b |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
SP1: | - | ||||||||||||||||||||||||||||||||||||||||
SP2: | - | - | |||||||||||||||||||||||||||||||||||||||
SP3: | - | - | - | ||||||||||||||||||||||||||||||||||||||
SP4: | - | - | |||||||||||||||||||||||||||||||||||||||
SP5: | - | - | |||||||||||||||||||||||||||||||||||||||
SP6: | - | - | |||||||||||||||||||||||||||||||||||||||
SP7: |
Expression for ALAS1 Gene
mRNA differential expression in normal tissues according to GTEx for ALAS1 Gene
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for ALAS1 Gene
NURSA nuclear receptor signaling pathways regulating expression of ALAS1 Gene:
ALAS1SOURCE GeneReport for Unigene cluster for ALAS1 Gene:
Hs.476308Evidence on tissue expression from TISSUES for ALAS1 Gene
- Liver(4.7)
- Muscle(4.4)
- Nervous system(4.4)
- Blood(2.7)
- Adrenal gland(2.5)
Primer Products
-
OriGene qPCR primer pairs for ALAS1
-
OriGene qPCR primer pairs and template standards for ALAS1
- genomics-online: primer clones - Search results for 122 available ALAS1 gene related products
- Overview of 122 available ALAS1 gene related products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for ALAS1 Gene
Orthologs for ALAS1 Gene
This gene was present in the common ancestor of animals and fungi.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | ALAS1 33 34 |
|
||
dog (Canis familiaris) |
Mammalia | ALAS1 33 34 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | ALAS1 34 |
|
OneToOne | |
cow (Bos Taurus) |
Mammalia | ALAS1 33 34 |
|
||
platypus (Ornithorhynchus anatinus) |
Mammalia | ALAS1 34 |
|
OneToOne | |
mouse (Mus musculus) |
Mammalia | Alas1 33 16 34 |
|
||
rat (Rattus norvegicus) |
Mammalia | Alas1 33 |
|
||
chicken (Gallus gallus) |
Aves | ALAS1 33 34 |
|
||
lizard (Anolis carolinensis) |
Reptilia | ALAS1 34 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | alas1 33 |
|
||
Str.5235 33 |
|
||||
African clawed frog (Xenopus laevis) |
Amphibia | MGC68700 33 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | alas1 33 34 |
|
||
rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.8381 33 |
|
||
fruit fly (Drosophila melanogaster) |
Insecta | Alas 35 34 |
|
||
baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | HEM1 34 |
|
OneToMany | |
sea squirt (Ciona savignyi) |
Ascidiacea | CSA.8623 34 |
|
OneToMany | |
sea squirt (Ciona intestinalis) |
Ascidiacea | Cin.9850 33 |
|
- Species where no ortholog for ALAS1 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for ALAS1 Gene
(1) SIMAP similar genes for ALAS1 Gene using alignment to 4 proteins:
Pseudogenes.org Pseudogenes for ALAS1 Gene
Variants for ALAS1 Gene
SNP ID | Clin | Chr 03 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs1000023450 | -- | 52,209,986(+) | G/A | intron_variant | |
rs1000263455 | -- | 52,196,627(+) | T/C | upstream_transcript_variant | |
rs1000338998 | -- | 52,196,844(+) | G/C | upstream_transcript_variant | |
rs1000521004 | -- | 52,212,416(+) | C/G | coding_sequence_variant, missense_variant | |
rs1000544499 | -- | 52,203,479(+) | TGCAATGAGTC/TGCAATGAGTCTGCAATGAGTC | intron_variant |
Variant ID | Type | Subtype | PubMed ID |
---|---|---|---|
nsv460537 | CNV | loss | 19166990 |
nsv470572 | CNV | loss | 18288195 |
nsv508218 | CNV | deletion | 20534489 |
nsv508926 | CNV | insertion | 20534489 |
nsv519445 | CNV | gain+loss | 19592680 |
nsv590301 | CNV | loss | 21841781 |
nsv834694 | CNV | gain | 17160897 |
nsv834695 | CNV | loss | 17160897 |
nsv954858 | CNV | deletion | 24416366 |
Additional Variant Information for ALAS1 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ALAS1 Gene
Disorders for ALAS1 Gene
Disorder | Aliases | PubMed IDs |
---|---|---|
anemia, sideroblastic, 1 |
|
|
acute porphyria |
|
|
porphyria, acute intermittent |
|
|
sideroblastic anemia |
|
|
porphyria |
|
Additional Disease Information for ALAS1
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for UniProtKB/Swiss-Prot and Genatlas for ALAS1 Gene
Publications for ALAS1 Gene
- Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 44 58
- Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson SL … O'Brien SJ (PloS one 2010) 3 44 58
- Down-regulation of aminolevulinate synthase, the rate-limiting enzyme for heme biosynthesis in Alzheimer's disease. (PMID: 19477221) Dwyer BE … Zhu X (Neuroscience letters 2009) 3 22 58
- Functional analysis of the 5' regulatory region of the 5-aminolevulinate synthase (ALAS1) gene in response to estrogen. (PMID: 19656447) du Plessis N … Warnich L (Cellular and molecular biology (Noisy-le-Grand, France) 2009) 3 22 58
- Differential regulation of human ALAS1 mRNA and protein levels by heme and cobalt protoporphyrin. (PMID: 18719978) Zheng J … Bonkovsky HL (Molecular and cellular biochemistry 2008) 3 22 58
Products for ALAS1 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for ALAS1
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for ALAS1
- Search Origene for MassSpec and Protein Over-expression Lysates for ALAS1
- Origene Custom Protein Services for ALAS1
- Origene shrna, sirna, and RNAi products in human, mouse, rat for ALAS1
- Browse OriGene Inhibitory RNA Products For ALAS1
- OriGene qPCR primer pairs and template standards for ALAS1
- OriGene qPCR primer pairs for ALAS1
- OriGene CRISPR knockouts for ALAS1
- OriGene ORF clones in human for ALAS1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For ALAS1
- GenScript: Next-day shipping of latest version cDNA ORF clones for ALAS1 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for ALAS1
- GenScript Custom Assay Services for ALAS1
- GenScript Custom overexpressing Cell Line Services for ALAS1
- GenScript: Design CRISPR guide RNA sequences for ALAS1
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for ALAS1
- Sino Biological Human cDNA Clone for ALAS1
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for ALAS1
- Novus Biologicals lysates and proteins for ALAS1
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Abcam antibodies for ALAS1
- Abcam proteins for ALAS1
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for ALAS1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Cyagen custom Knockout/knockin (KOKI) mouse models for ALAS1
- VectorBuilder custom plasmid, inducible vectors for ALAS1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for ALAS1
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for available ALAS1 related products ranked by validation data
- antibodies-online: Search results for available ALAS1 related products ranked by validation data
- antibodies-online: Search results for available ALAS1 related products ranked by validation data
- GeneTex ALAS1 antibody for ALAS1
- Search GeneTex for Proteins for ALAS1
- ViGene Biosciences adenoviral particle packaged cDNA for ALAS1 gene
- ViGene Biosciences lentiviral particle packaged cDNA for ALAS1 gene
- ViGene Biosciences ready-to-package AAV shRNAs for ALAS1 gene
- Search ViGene Biosciences for ALAS1
- Santa Cruz Biotechnology (SCBT) Antibodies for ALAS1
- Search Santa Cruz Biotechnology (SCBT) for ALAS1 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for ALAS1
- Horizon Cell Lines for ALAS1
- genomics-online: cdna clones - Search results for 122 available ALAS1 gene related products
- Overview of 122 available ALAS1 gene related products
- orf clones - Search results for 122 available ALAS1 gene related products
- Overview of 122 available ALAS1 gene related products
- genomics-online: gRNA clones - Search results for 122 available ALAS1 gene related products
- Overview of 122 available ALAS1 gene related products
- genomics-online: primer clones - Search results for 122 available ALAS1 gene related products
- Overview of 122 available ALAS1 gene related products
- genomics-online: shRNA clones - Search results for 122 available ALAS1 gene related products
- Overview of 122 available ALAS1 gene related products
Sources for ALAS1 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew