Free for academic non-profit institutions. Other users need a Commercial license

Aliases for AKAP1 Gene

Aliases for AKAP1 Gene

  • A-Kinase Anchoring Protein 1 2 3 5
  • Dual Specificity A-Kinase-Anchoring Protein 1 2 4
  • Protein Phosphatase 1, Regulatory Subunit 43 2 3
  • Spermatid A-Kinase Anchor Protein 84 3 4
  • A Kinase (PRKA) Anchor Protein 1 2 3
  • A-Kinase Anchor Protein 149 KDa 3 4
  • Tudor Domain Containing 17 2 3
  • AKAP 149 3 4
  • D-AKAP-1 3 4
  • AKAP149 3 4
  • PRKA1 3 4
  • Dual-Specificity A-Kinase Anchoring Protein 1 3
  • A-Kinase Anchor Protein 1, Mitochondrial 3
  • Protein Kinase A Anchoring Protein 1 3
  • Protein Kinase A-Anchoring Protein 1 4
  • Protein Kinase Anchoring Protein 1 2
  • Testicular Secretory Protein Li 5 3
  • Protein Kinase A1 3
  • S-AKAP84 4
  • AKAP121 3
  • D-AKAP1 3
  • PPP1R43 3
  • SAKAP84 3
  • AKAP84 3
  • TDRD17 3
  • AKAP 3

External Ids for AKAP1 Gene

Previous HGNC Symbols for AKAP1 Gene

  • PRKA1

Previous GeneCards Identifiers for AKAP1 Gene

  • GC17P054899
  • GC17P057644
  • GC17P055504
  • GC17P055637
  • GC17P052517
  • GC17P055162
  • GC17P050523

Summaries for AKAP1 Gene

Entrez Gene Summary for AKAP1 Gene

  • The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to type I and type II regulatory subunits of PKA and anchors them to the mitochondrion. This protein is speculated to be involved in the cAMP-dependent signal transduction pathway and in directing RNA to a specific cellular compartment. [provided by RefSeq, Jul 2008]

GeneCards Summary for AKAP1 Gene

AKAP1 (A-Kinase Anchoring Protein 1) is a Protein Coding gene. Among its related pathways are Activation of cAMP-Dependent PKA and Factors involved in megakaryocyte development and platelet production. GO annotations related to this gene include nucleic acid binding and RNA binding.

UniProtKB/Swiss-Prot for AKAP1 Gene

  • Binds to type I and II regulatory subunits of protein kinase A and anchors them to the cytoplasmic face of the mitochondrial outer membrane.

Gene Wiki entry for AKAP1 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AKAP1 Gene

Genomics for AKAP1 Gene

Regulatory Elements for AKAP1 Gene

Enhancers for AKAP1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH17F057105 1 Ensembl ENCODE 24.2 +23.4 23391 6.4 ARID4B GLIS2 FOS GLIS1 HMBOX1 HNF4A KDM1A SP7 CTCF KLF1 AKAP1 RNU7-134P CCDC182 ENSG00000263004 ENSG00000263089 GC17P057199
GH17F057053 0.5 Ensembl ENCODE 17.3 -30.6 -30618 1.2 PKNOX1 RAD21 ZNF263 NCOA1 CEBPB ZEB2 ZNF585B SMARCA4 IKZF1 CEBPA AKAP1 DGKE SRSF1 RNF126P1 GC17P057054 ENSG00000263004
GH17F057050 0.2 ENCODE 17.1 -34.5 -34462 1.0 CTCF AKAP1 GC17P057054 ENSG00000263004
GH17F057104 0.2 ENCODE 12.9 +19.9 19883 0.2 MAFK AKAP1 ENSG00000263089 GC17P057199
GH17F057101 0.6 Ensembl 12.7 +17.0 17009 1.0 OSR2 IKZF1 TCF7 WT1 SPI1 AKAP1 CCDC182 ENSG00000263089 GC17P057199
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around AKAP1 on UCSC Golden Path with GeneCards custom track

Promoters for AKAP1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00001536865 608 3001 HDGF PKNOX1 ARNT CREB3L1 MLX ZFP64 ARID4B SIN3A DMAP1 ZNF2

Genomic Location for AKAP1 Gene

Chromosome:
17
Start:
57,085,092 bp from pter
End:
57,121,349 bp from pter
Size:
36,258 bases
Orientation:
Plus strand

Genomic View for AKAP1 Gene

Genes around AKAP1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AKAP1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AKAP1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for AKAP1 Gene

Proteins for AKAP1 Gene

  • Protein details for AKAP1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q92667-AKAP1_HUMAN
    Recommended name:
    A-kinase anchor protein 1, mitochondrial
    Protein Accession:
    Q92667
    Secondary Accessions:
    • A8K8Q1
    • D3DTZ0
    • Q13320
    • Q9BW14

    Protein attributes for AKAP1 Gene

    Size:
    903 amino acids
    Molecular mass:
    97342 Da
    Quaternary structure:
    • Interacts with SLC8A3.

    Alternative splice isoforms for AKAP1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for AKAP1 Gene

Post-translational modifications for AKAP1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Antibody Products

  • Cell Signaling Technology (CST) Antibodies for AKAP1 (AKAP1)
  • Abcam antibodies for AKAP1

No data available for DME Specific Peptides for AKAP1 Gene

Domains & Families for AKAP1 Gene

Protein Domains for AKAP1 Gene

Suggested Antigen Peptide Sequences for AKAP1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q92667

UniProtKB/Swiss-Prot:

AKAP1_HUMAN :
  • RII-alpha binding site, predicted to form an amphipathic helix, could participate in protein-protein interactions with a complementary surface on the R-subunit dimer.
Domain:
  • RII-alpha binding site, predicted to form an amphipathic helix, could participate in protein-protein interactions with a complementary surface on the R-subunit dimer.
  • Contains 1 KH domain.
  • Contains 1 Tudor domain.
genes like me logo Genes that share domains with AKAP1: view

Function for AKAP1 Gene

Molecular function for AKAP1 Gene

GENATLAS Biochemistry:
A kinase (PRKA regulatory subunit RIIA) anchor protein 1
UniProtKB/Swiss-Prot Function:
Binds to type I and II regulatory subunits of protein kinase A and anchors them to the cytoplasmic face of the mitochondrial outer membrane.

Gene Ontology (GO) - Molecular Function for AKAP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003723 RNA binding TAS 8769136
GO:0005515 protein binding IPI 16642035
GO:0034237 protein kinase A regulatory subunit binding IPI 17911601
GO:0044822 poly(A) RNA binding IDA 22658674
genes like me logo Genes that share ontologies with AKAP1: view
genes like me logo Genes that share phenotypes with AKAP1: view

Animal Models for AKAP1 Gene

MGI Knock Outs for AKAP1:

Animal Model Products

Inhibitory RNA Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for AKAP1 Gene

Localization for AKAP1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for AKAP1 Gene

Mitochondrion outer membrane.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for AKAP1 Gene COMPARTMENTS Subcellular localization image for AKAP1 gene
Compartment Confidence
cytosol 5
mitochondrion 5
plasma membrane 4
cytoskeleton 2
endoplasmic reticulum 2
nucleus 2
extracellular 1
peroxisome 1

Gene Ontology (GO) - Cellular Components for AKAP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IDA --
GO:0005741 mitochondrial outer membrane IEA --
GO:0005829 cytosol TAS --
GO:0016020 membrane IEA,IDA 19946888
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with AKAP1: view

Pathways & Interactions for AKAP1 Gene

genes like me logo Genes that share pathways with AKAP1: view

Pathways by source for AKAP1 Gene

1 Cell Signaling Technology pathway for AKAP1 Gene
1 BioSystems pathway for AKAP1 Gene

Gene Ontology (GO) - Biological Process for AKAP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007596 blood coagulation TAS --
GO:0010738 regulation of protein kinase A signaling IEA --
genes like me logo Genes that share ontologies with AKAP1: view

No data available for SIGNOR curated interactions for AKAP1 Gene

Drugs & Compounds for AKAP1 Gene

(6) Drugs for AKAP1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(3) Additional Compounds for AKAP1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with AKAP1: view

Transcripts for AKAP1 Gene

Unigene Clusters for AKAP1 Gene

A kinase (PRKA) anchor protein 1:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for AKAP1 Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3a · 3b · 3c ^ 4 ^ 5a · 5b · 5c · 5d ^ 6 ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11 ^ 12a · 12b ^ 13 ^ 14 ^ 15 ^ 16 ^ 17
SP1: - - - - - - - -
SP2: -
SP3: -
SP4:
SP5: -
SP6: - - - - -
SP7: - - - -

Relevant External Links for AKAP1 Gene

GeneLoc Exon Structure for
AKAP1
ECgene alternative splicing isoforms for
AKAP1

Expression for AKAP1 Gene

mRNA expression in normal human tissues for AKAP1 Gene

Protein differential expression in normal tissues from HIPED for AKAP1 Gene

This gene is overexpressed in Adrenal (29.4) and Lung (13.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for AKAP1 Gene



Protein tissue co-expression partners for AKAP1 Gene

NURSA nuclear receptor signaling pathways regulating expression of AKAP1 Gene:

AKAP1

SOURCE GeneReport for Unigene cluster for AKAP1 Gene:

Hs.463506

mRNA Expression by UniProt/SwissProt for AKAP1 Gene:

Q92667-AKAP1_HUMAN
Tissue specificity: Isoform 1 is detected in thymus, prostate, testis, ovary, colon and small intestine (PubMed:8769136). Isoform 2 is highly expressed in testis and detected at much lower levels in kidney, pancreas, liver, lung and brain (PubMed:7499250).
genes like me logo Genes that share expression patterns with AKAP1: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for AKAP1 Gene

Orthologs for AKAP1 Gene

This gene was present in the common ancestor of animals.

Orthologs for AKAP1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia AKAP1 34 35
  • 99.04 (n)
oppossum
(Monodelphis domestica)
Mammalia -- 35
  • 86 (a)
OneToMany
-- 35
  • 38 (a)
OneToMany
dog
(Canis familiaris)
Mammalia AKAP1 34 35
  • 80.36 (n)
rat
(Rattus norvegicus)
Mammalia Akap1 34
  • 78.58 (n)
mouse
(Mus musculus)
Mammalia Akap1 34 16 35
  • 77.37 (n)
cow
(Bos Taurus)
Mammalia AKAP1 34 35
  • 76.72 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia AKAP1 35
  • 53 (a)
OneToOne
chicken
(Gallus gallus)
Aves AKAP1 34 35
  • 57.06 (n)
lizard
(Anolis carolinensis)
Reptilia AKAP1 35
  • 73 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.10032 34
zebrafish
(Danio rerio)
Actinopterygii akap1b 35
  • 40 (a)
OneToOne
akap1 34
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.2949 34
fruit fly
(Drosophila melanogaster)
Insecta spoon 35
  • 24 (a)
OneToOne
worm
(Caenorhabditis elegans)
Secernentea C56G2.1a 36
  • 33 (a)
C56G2.1b 36
  • 33 (a)
akap-1 35
  • 20 (a)
OneToOne
Species where no ortholog for AKAP1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for AKAP1 Gene

ENSEMBL:
Gene Tree for AKAP1 (if available)
TreeFam:
Gene Tree for AKAP1 (if available)

Paralogs for AKAP1 Gene

No data available for Paralogs for AKAP1 Gene

Variants for AKAP1 Gene

Sequence variations from dbSNP and Humsavar for AKAP1 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs148312142 Uncertain significance 57,105,703(+) AGAAA(A/G)GGAAC nc-transcript-variant, reference, missense
rs746089021 Uncertain significance 57,106,390(+) GGAGA(-/GCTTGGATAGAAATGAGGAGG)GCTTG nc-transcript-variant, cds-indel
rs10445348 -- 57,086,467(+) TCCTC(A/T)CCTGG intron-variant, utr-variant-5-prime
rs1050515 -- 57,106,355(+) CAGGA(C/T)AGAGG nc-transcript-variant, reference, synonymous-codon
rs1050516 -- 57,106,656(+) CTGTC(C/T)TGGGC nc-transcript-variant, reference, synonymous-codon

Structural Variations from Database of Genomic Variants (DGV) for AKAP1 Gene

Variant ID Type Subtype PubMed ID
esv33941 CNV loss 17666407
esv3640867 CNV loss 21293372
nsv111740 CNV deletion 16902084

Variation tolerance for AKAP1 Gene

Residual Variation Intolerance Score: 60.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.39; 77.04% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for AKAP1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
AKAP1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AKAP1 Gene

Disorders for AKAP1 Gene

Relevant External Links for AKAP1

Genetic Association Database (GAD)
AKAP1
Human Genome Epidemiology (HuGE) Navigator
AKAP1
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
AKAP1

No disorders were found for AKAP1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for AKAP1 Gene

Publications for AKAP1 Gene

  1. Molecular characterization of AKAP149, a novel A kinase anchor protein with a KH domain. (PMID: 8769136) Trendelenburg G. … Hanski C. (Biochem. Biophys. Res. Commun. 1996) 2 3 4 22 64
  2. Characterization of S-AKAP84, a novel developmentally regulated A kinase anchor protein of male germ cells. (PMID: 7499250) Lin R.-Y. … Rubin C.S. (J. Biol. Chem. 1995) 2 3 4 22 64
  3. An approach based on a genome-wide association study reveals candidate loci for narcolepsy. (PMID: 20677014) Shimada M. … Tokunaga K. (Hum. Genet. 2010) 3 46 64
  4. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson S.L. … O'Brien S.J. (PLoS ONE 2010) 3 46 64
  5. Mutually exclusive binding of PP1 and RNA to AKAP149 affects the mitochondrial network. (PMID: 19074462) Rogne M. … KA1ntziger T. (Hum. Mol. Genet. 2009) 3 22 64

Products for AKAP1 Gene

Sources for AKAP1 Gene

Content
Loading form....