Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

ADRB2 Gene

protein-coding   GIFtS: 70
GCID: GC05P148186

adrenoceptor beta 2, surface

(Previous names: adrenergic, beta-2-, receptor, surface )
(Previous symbol: ADRB2R)
 Explore 157 diseases affiliated with
ADRB2 via our new
 Human Malady Compendium 
Biological research products
for ADRB2
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Adrenoceptor Beta 2, Surface1 2     Beta-2 Adrenoceptor2 3
ADRB2R1 2 3     Beta-2 Adrenoreceptor2 3
B2AR1 2 3     BETA2AR2
ADRBR1 2     Beta-2 Adrenergic Receptor2
BAR1 2     Catecholamine Receptor2
Adrenergic, Beta-2-, Receptor, Surface1 2     

External Ids:    HGNC: 2861   Entrez Gene: 1542   Ensembl: ENSG000001692527   OMIM: 1096905   UniProtKB: P075503   

Export aliases for ADRB2 gene to outside databases

Previous GC identifers: GC05P148250 GC05M148800 GC05P148187 GC05P148235 GC05P148236 GC05P143352


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for ADRB2:
This gene encodes beta-2-adrenergic receptor which is a member of the G protein-coupled receptor superfamily. This
receptor is directly associated with one of its ultimate effectors, the class C L-type calcium channel Ca(V)1.2. This
receptor-channel complex also contains a G protein, an adenylyl cyclase, cAMP-dependent kinase, and the
counterbalancing phosphatase, PP2A. The assembly of the signaling complex provides a mechanism that ensures specific
and rapid signaling by this G protein-coupled receptor. This gene is intronless. Different polymorphic forms, point
mutations, and/or downregulation of this gene are associated with nocturnal asthma, obesity and type 2 diabetes.
(provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: ADRB2_HUMAN, P07550
Function: Beta-adrenergic receptors mediate the catecholamine-induced activation of adenylate cyclase through the
action of G proteins. The beta-2-adrenergic receptor binds epinephrine with an approximately 30-fold greater affinity
than it does norepinephrine

summary for ADRB2:
The adrenergic beta2 receptor (beta2-adrenoceptor) is a member of the adrenergic receptor group of
G-protein-coupled receptors that also includes alpha1A, alpha1B, alpha1D, alpha2A, alpha2B, alpha2C, beta1
and beta3. They are located primarily in the CNS, heart, kidney and muscle where they are involved in smooth
muscle relaxation (e.g. bronchodilation). The human adrenergic beta2 receptor gene has been localized to
chromosome 5 (5q31-q32).

Gene Wiki entry for ADRB2 (Beta-2 adrenergic receptor)

PharmGKB "VIP" summary for ADRB2


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000005.9  NC_018916.1  NT_029289.11  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the ADRB2 gene promoter:
         CREB   p53   deltaCREB   STAT3   MyoD   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): ADRB2 promoter sequence
   Search SABiosciences Chromatin IP Primers for ADRB2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ADRB2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 5q31-q32   Ensembl cytogenetic band:  5q32   HGNC cytogenetic band: 5q31-q32

ADRB2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ADRB2 gene location

GeneLoc information about chromosome 5         GeneLoc Exon Structure

GeneLoc location for GC05P148186:  view genomic region     (about GC identifiers)

Start:
148,206,156 bp from pter      End:
148,208,197 bp from pter
Size:
2,042 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: ADRB2_HUMAN, P07550 (See protein sequence)
Recommended Name: Beta-2 adrenergic receptor  
Size: 413 amino acids; 46459 Da
Subunit: Binds SLC9A3R1 and GPRASP1. Interacts with ARRB1 and ARRB2. Interacts with SRC, USP20 and USP33. Interacts
with VHL; the interaction, which is increased on hydroxylation of ADRB2, ubiquitinates ADRB2 leading to its
degradation. Interacts with EGLN3; the interaction hydroxylates ADRB2 facilitating VHL-E3 ligase-mediated
ubiquitination
Subcellular location: Cell membrane; Multi-pass membrane protein. Note=Colocalizes with VHL at the cell membrane
Sequence caution: Sequence=BAD96745.1; Type=Erroneous initiation; Note=Translation N-terminally shortened;
6/13 PDB 3D structures from and Proteopedia for ADRB2 (see all 13):
1GQ4 (3D)        2R4R (3D)        2R4S (3D)        2RH1 (3D)        3D4S (3D)        3KJ6 (3D)    
Secondary accessions: B0LPE4 B2R7X2 O14823 O14824 O14825 O14826 Q4JG18 Q53GA6 Q6GMT4 Q6P4D8 Q8NEQ9
Q96EC3 Q9UCZ0 Q9UCZ1 Q9UCZ2 Q9UCZ3 Q9UH95 Q9UHA1 Q9UMZ5

Explore the universe of human proteins at neXtProt for ADRB2: NX_P07550

Post-translational modifications:

  • Palmitoylated; may reduce accessibility of Ser-345 and Ser-346 by anchoring Cys-341 to the plasma membrane. Agonist
  • stimulation promotes depalmitoylation and further allows Ser-345 and Ser-346 phosphorylation1
  • Phosphorylated by PKA and BARK upon agonist stimulation, which mediates homologous desensitization of the receptor.
  • PKA-mediated phosphorylation seems to facilitate phosphorylation by BARK1
  • Phosphorylation of Tyr-141 is induced by insulin and leads to supersensitization of the receptor1
  • Polyubiquitinated. Agonist-induced ubiquitination leads to sort internalized receptors to the lysosomes for
  • degradation. Deubiquitination by USP20 and USP33, leads to ADRB2 recycling and resensitization after prolonged agonist
    stimulation. USP20 and USP33 are constitutively associated and are dissociated immediately after agonist stimulation.
    Ubiquitination by the VHL-E3 ligase complex is oxygen-dependent1
  • Hydroxylation by EGLN3 occurs only under normoxia and increases the interaction with VHL and the subsequent
  • ubiquitination and degradation of ADRB21
  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_P07550

  • ADRB2 Protein expression data from MOPED and PaxDb:    About this image 
    ADRB2 Protein Expression
    REFSEQ proteins: NP_000015.1  
    ENSEMBL proteins: 
     ENSP00000305372  
    Reactome Protein details: P07550
    Human Recombinant Protein Products for ADRB2: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate: ADRB2
    OriGene Custom Protein Services for ADRB2 
    GenScript Custom Purified and Recombinant Proteins Services for ADRB2
    Novus Biologicals ADRB2 Protein
    Novus Biologicals ADRB2 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Uscn

    Gene Ontology (GO): 5/17 cellular component terms (GO ID links to tree view) (see all 17):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005624membrane fraction ----
    GO:0005634nucleus IEA--
    GO:0005737cytoplasm ----
    GO:0005764lysosome TAS9507004
    GO:0005768endosome TAS10734107

    ADRB2 for ontologies           About GeneDecksing



    ADRB2 Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of ADRB2
    Browse R&D Systems for Antibodies
    Cell Signaling Technology (CST) Antibodies for ADRB2 
    OriGene Antibodies: ADRB2
    OriGene Custom Antibody Services for ADRB2 
    GenScript Custom Superior Antibodies Services for ADRB2
    Novus Biologicals ADRB2 Antibodies
    Abcam antibodies for ADRB2 
    Browse Antibodies at Uscn
    ThermoFisher Antibodies for ADRB2

    Assay Products for ADRB2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript ADRB2-overexpressing Cell Line for Assay
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs and CLIAs at Uscn


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    ADRB2 for domains           About GeneDecksing

    4 InterPro domains/families:
     IPR017452 GPCR_Rhodpsn_7TM
     IPR002233 Adrnrgc_rcpt
     IPR000276 GPCR_Rhodpsn
     IPR000332 Adrgc_rcpt_B2

    Graphical View of Domain Structure for InterPro Entry P07550

    ProtoNet protein and cluster: P07550

    2 Blocks protein families:
    IPB000332 Beta-2 adrenergic receptor signature
    IPB002233 Adrenergic receptor signature


    UniProtKB/Swiss-Prot: ADRB2_HUMAN, P07550
    Similarity: Belongs to the G-protein coupled receptor 1 family. Adrenergic receptor subfamily. ADRB2 sub-subfamily


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: ADRB2_HUMAN, P07550
    Function: Beta-adrenergic receptors mediate the catecholamine-induced activation of adenylate cyclase through the
    action of G proteins. The beta-2-adrenergic receptor binds epinephrine with an approximately 30-fold greater affinity
    than it does norepinephrine

         Genatlas biochemistry entry for ADRB2:
    adrenergic,beta-2-,receptor,G protein coupled receptor superfamily,activating adenylate cyclase,major lipolytic
    receptor in human fat cell altered in obesity,also associated to susceptibility to hypertension (polymorphism,R16G)

         Gene Ontology (GO): 5/10 molecular function terms (GO ID links to tree view) (see all 10):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004941beta2-adrenergic receptor activity IDA15123695
    GO:0005515protein binding IPI15123695
    GO:0008144drug binding ----
    GO:0008179adenylate cyclase binding IEA--
    GO:0015459potassium channel regulator activity IDA12297500
         
    ADRB2 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for ADRB2:
     Decreased G3BP1 protein expres  Large nuclei 

         12 MGI mutant phenotypes (inferred from 3 alleles(MGI details for Adrb2):
     adipose tissue  behavior/neurological  cardiovascular system  cellular  endocrine/exocrine gland 
     growth/size  hematopoietic system  homeostasis/metabolism  immune system  muscle 
     no phenotypic analysis  skeleton 

    ADRB2 for phenotypes           About GeneDecksing

    Animal Models:
         Mouse knock-out Adrb2tm1Bkk for ADRB2
       inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for ADRB2 

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: ADRB2
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ADRB2
    8/10 QIAGEN miScript miRNA Assays for microRNAs that regulate ADRB2 (see all 10):
    hsa-miR-98 hsa-let-7d hsa-let-7c hsa-let-7i hsa-miR-1284 hsa-let-7g hsa-let-7e hsa-let-7b
    SwitchGear 3'UTR luciferase reporter plasmidADRB2 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ADRB2 (see all 7)
    OriGene shRNA RFP: ADRB2
    OriGene siRNA: ADRB2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ADRB2
    Sirion Biotech Custom design and validation of potent shRNA sequences against ADRB2 

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ADRB2
    Sirion Biotech Customized adenovirus for overexpression of ADRB2 
    Sirion Biotech Customized adenovirus for potent knockdown of ADRB2

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ADRB2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ADRB2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: ADRB2 (NM_000024)
    Sino Biological Human cDNA Clone for ADRB2
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ADRB2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ADRB2 

    Cell Line
    Products:
         
    GenScript ADRB2-overexpressing Cell Line for Assay
    Search LifeMap BioReagents cell lines for ADRB2
    Sirion Biotech Customized stable knockdown cell line services for ADRB2 
    Sirion Biotech Customized inducible knockdown cell line services for ADRB2
    Sirion Biotech Customized stable overexpressing cell line services for ADRB2
    Sirion Biotech Customized inducible overexpressing cell line services for ADRB2

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ADRB2


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways - 5/25 super-pathways (see all 25About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Class A/1 (Rhodopsin-like receptors)
    Class A/1 (Rhodopsin-like receptors)1.00
    GPCRs, Class A Rhodopsin-like0.41
    GPCR ligand binding0.75
    Neuroactive ligand-receptor interaction0.38
    2Activation of cAMP-Dependent PKA
    Activation of cAMP-Dependent PKA1.00
    Activation of PKA through GPCR0.71
    cAMP Pathway0.77
    3Signaling by GPCR
    Signaling by GPCR1.00
    Signal Transduction0.56
    GPCR downstream signaling0.89
    4PKA activation in glucagon signalling
    Beta-2 adrenergic-dependent CFTR expression0.74
    Development_Beta-adrenergic receptors signaling via cAMP0.29
    Development Beta-adrenergic receptors signaling via cAMP0.29
    5wtCFTR and deltaF508 traffic / Membrane expression (norm and CF)
    wtCFTR and deltaF508 traffic / Membrane expression (norm and CF)1.00
    Regulation of CFTR activity (norm and CF)0.38

    Pathway sources
    See GeneCards unified pathways
    Show all pathways

    4 EMD Millipore Pathways for ADRB2
        Development Beta-adrenergic receptors regulation of ERK
    Development Beta-adrenergic receptors signaling via cAMP
    Transcription CREB pathway
    Development Ligand-independent activation of ESR1 and ESR2

    5 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for ADRB2
        Activation of PKA through GPCR
    cAMP Pathway
    Activation of cAMP-Dependent PKA
    Signaling Involved in Cardiac Hypertrophy
    Beta-Adrenergic Signaling

    2 Cell Signaling Technology (CST) Pathways for ADRB2
        Ca, cAMP and Lipid Signaling
    Neuroscience

    5/7 GeneGo (Thomson Reuters) Pathways for ADRB2 (see all 7)
        Development Ligand-independent activation of ESR1 and ESR2
    Development Beta-adrenergic receptors signaling via cAMP
    Beta-2 adrenergic-dependent CFTR expression
    Transcription CREB pathway
    Regulation of CFTR activity (norm and CF)

    5/6 BioSystems Pathways for ADRB2 (see all 6
        Calcium Regulation in the Cardiac Cell
    GPCRs, Class A Rhodopsin-like
    GPCRs, Other
    Arf6 trafficking events
    Arf6 signaling events

    5/8        Reactome Pathways for ADRB2 (see all 8)
        GPCR downstream signaling
    Signaling by GPCR
    GPCR ligand binding
    Adrenoceptors
    Class A/1 (Rhodopsin-like receptors)

    3 PharmGKB Pathways for ADRB2
        Antiarrhythmic Pathway, Pharmacodynamics
    Beta-agonist/Beta-blocker Pathway, Pharmacodynamics
    Sympathetic Nerve Pathway (Neuroeffector Junction)

    4         Kegg Pathways  (Kegg details for ADRB2):
        Calcium signaling pathway
    Neuroactive ligand-receptor interaction
    Endocytosis
    Salivary secretion


    ADRB2 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for ADRB2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/124 Interacting proteins for ADRB2 (P075502, 3 ENSP000003053724) via UniProtKB, MINT, STRING, and/or I2D (see all 124)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SLC9A3R1O147452, 3, ENSP000002626134MINT-1796489 MINT-2842955 MINT-1796525 MINT-2843018 MINT-2842994 MINT-1796656 MINT-2842879 MINT-2842917 I2D: score=6 STRING: ENSP00000262613
    MAGI3Q5TCQ92, 3, ENSP000003046044MINT-7716320 MINT-7716382 MINT-7716556 MINT-7716470 MINT-7716630 MINT-7716422 MINT-7716450 MINT-7716335 MINT-7716502 I2D: score=2 STRING: ENSP00000304604
    LAMP2P134732, 3, ENSP000004084114MINT-7291650 I2D: score=1 STRING: ENSP00000408411
    SRCP129312, 3, ENSP000003509414MINT-4051805 MINT-4051815 MINT-4051585 I2D: score=4 STRING: ENSP00000350941
    USP33Q8TEY72, 3, ENSP000003500094MINT-7291631 MINT-7291604 I2D: score=1 STRING: ENSP00000350009
    About this table

    Gene Ontology (GO): 5/41 biological process terms (GO ID links to tree view) (see all 41):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001993regulation of systemic arterial blood pressure by norepinephrine-epinephrine ----
    GO:0002024diet induced thermogenesis IEA--
    GO:0002025vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure IEA--
    GO:0002028regulation of sodium ion transport IEA--
    GO:0002032desensitization of G-protein coupled receptor protein signaling pathway by arrestin IDA15123695

    ADRB2 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    ADRB2 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Compounds for ADRB2 available from Tocris Bioscience    About this table
    CompoundAction CAS #
    ICI 118,551 hydrochloride Very selective beta2 antagonist[72795-01-8]
    SalmeterolPotent beta2 agonist; long acting[89365-50-4]
    Salbutamol hemisulfatebeta agonist (beta2 > beta1)[51022-70-9]
    Formoterol hemifumaratePotent and selective beta2 agonist[183814-30-4]

    5 HMDB Compounds for ADRB2    About this table
    CompoundSynonyms CAS #PubMed Ids
    Epinephrine(-)-(R)-Epinephrine (see all 72)51-43-4--
    Norepinephrine(-)-(R)-Norepinephrine (see all 32)51-41-2--
    PropranololDociton (see all 8)525-66-6--
    Pseudoephedrine(+)-(1S,2S)-Pseudoephedrine (see all 25)90-82-4--
    Salbutamol(l)-albuterol (see all 97)18559-94-9--

    10/47 DrugBank Compounds for ADRB2 (see all 47)    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    FormoterolFormoterol fumarate (see all 2)73573-87-2targetagonist17594727 14720051 12090787 9506248 11752352 16432501 1718682 18686730 7675115 14662724 2544117
    TerbutalineTerbutalin (see all 5)23031-25-6targetagonist2062329 1358833 11675405 11752352 20674738 18782903 11256987 12569076 11120594 10226872
    Arformoterol-- 67346-49-0targetagonist17352511 17594727 20406080 16022567 18501650 14725487 11752352 17472819
    NorepinephrineArterenol (see all 4)51-41-2targetagonist18064417 9666280 9464897 17139284 17016423 19110970 7969507 11504801
    Bambuterol-- 81732-46-9targetagonist20012638 8885698 8223836 11752352 3262993 18065099 12065188
    IsoproterenolEpinephrine Isopropyl Homolog (see all 14)7683-59-2targetagonist12963495 15151902 14656380 10722 11752352 15105445 14752060
    LabetalolLabetalol HCL (see all 4)36894-69-6targetantagonist19879818 1361547 2907566 6355664 11752352 7684671 8104240
    LevobunololLevobunolol HCl (see all 2)47141-42-4targetantagonist6147147 7928182 2891463 11752352 2892662 1351412 11572462
    TimololTimolol maleate (see all 2)26839-75-8targetantagonist16205624 9730867 11752352 8103526 8719802 9088585 10592235
    Bopindolol-- 69010-88-4targetpartial agonist1687398 1678274 1979630 16574446 11752352 1666931

    10/116 Novoseek chemical compound relationships for ADRB2 gene (see all 116)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    isoproterenol 84.9 122 10510435 (4), 15178407 (3), 17885618 (3), 10840035 (3) (see all 67)
    zinterol 77.1 8 18467626 (2), 9915773 (2), 9872996 (1), 9884381 (1)
    salbutamol 76.8 51 20335826 (3), 9873044 (3), 15557128 (2), 15687340 (2) (see all 31)
    icyp 75 2 1352549 (1), 15110997 (1)
    terbutaline 74 38 12966369 (4), 16153394 (3), 17718540 (2), 12869379 (2) (see all 16)
    catecholamine 73.2 102 7608992 (3), 11591153 (3), 8756182 (2), 8685890 (2) (see all 72)
    carazolol 72.6 4 19353579 (1), 7601122 (1), 17962520 (1), 18821775 (1)
    salmeterol 72.4 40 9765503 (5), 16980556 (4), 17030231 (4), 8798639 (3) (see all 14)
    alprenolol 70.5 3 10822171 (1), 11041870 (1), 9494078 (1)
    butoxamine 69.2 12 15145612 (1), 16551744 (1), 16645459 (1), 15458278 (1) (see all 5)

    3 PharmGKB related drug/compound annotations for ADRB2 gene    About this table
    Drug/compound PharmGKB Annotation
    carvedilolCA  
    salbutamolCA  
    salmeterolCA  
    Search CenterWatch for drugs/clinical trials and news about ADRB2 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for ADRB2 gene: 
    NM_000024.5  

    Unigene Cluster for ADRB2:

    Adrenoceptor beta 2, surface
    Hs.2551  [show with all ESTs]
    Unigene Representative Sequence: M15169
    1 Ensembl transcript including schematic representation, and UCSC links where relevant:
    ENST00000305988(uc003lpr.2)

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: ADRB2
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ADRB2
    8/10 QIAGEN miScript miRNA Assays for microRNAs that regulate ADRB2 (see all 10):
    hsa-miR-98 hsa-let-7d hsa-let-7c hsa-let-7i hsa-miR-1284 hsa-let-7g hsa-let-7e hsa-let-7b
    SwitchGear 3'UTR luciferase reporter plasmidADRB2 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ADRB2 (see all 7)
    OriGene shRNA RFP: ADRB2
    OriGene siRNA: ADRB2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ADRB2
    Sirion Biotech Custom design and validation of potent shRNA sequences against ADRB2 
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ADRB2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ADRB2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: ADRB2 (NM_000024)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ADRB2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ADRB2 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ADRB2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ADRB2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ADRB2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ADRB2

    Additional cDNA sequence: 

    AK223025.1 AK313151.1 AY136741.1 BC012481.2 BC063486.1 BC073856.1 M15169.1 X04827.1 

    1 DOTS entry:

    DT.313911 

    24/50 AceView cDNA sequences (see all 50):

    BC073856 BM544409 BQ447101 CR595085 AV647785 AL553611 BI915042 M15169 
    CA440083 NM_000024 BX092021 CN837362 AY136741 BQ017003 X04827 BM702832 
    BG256156 BC063486 BP366282 BP347785 BC012481 AA948091 R82937 BP380312 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    ADRB2 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: GACTCTTCCC
    ADRB2 Expression
    About this image

    ADRB2 expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table

    2 LifeMap In Vivo Development Anatomical Compartments/Cells 
    Tissue Anatomical Compartment CellCategory (developmental path)
    OvaryAntral FollicleCumulus CellsOvary
    LiverLiver LobuleLiver
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization
    Stem Cell Differentiation: 2 LifeMap Cells 
    NameCategory
    White adipocyte-like cells (Differentiation of w...)
    Brown adipocyte-like cells (Differentiation of w...)

    See ADRB2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for ADRB2

    SOURCE GeneReport for Unigene cluster: Hs.2551
        SABiosciences Expression via Pathway-Focused PCR Arrays including ADRB2 (see all 7): 
              Neurotransmitter Receptors in human mouse rat
              G-Protein-Coupled Receptor Signaling PathwayFinder in human mouse rat
              G Protein Coupled Receptors 384HT in human mouse rat
              Skeletal Muscle: Myogenesis & Myopathy in human mouse rat
              Gap Junctions in human mouse rat

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ADRB2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ADRB2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ADRB2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ADRB2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ADRB2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for ADRB2 gene from 4/15 species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves ADRB21 adrenergic, beta-2-, receptor, surface 78.47(n)
    80.27(a)
      427623  XM_425195.3  XP_425195.2 
    lizard
    (Anolis carolinensis)
    Reptilia ADRB26
    --
    67(a)
    1 ↔ 1
    2(123333789-123335460)
    African clawed frog
    (Xenopus laevis)
    Amphibia MGC687242 hypothetical protein MGC68724 78.83(n)    BC060426.1 
    zebrafish
    (Danio rerio)
    Actinopterygii adrb2b1 adrenergic receptor, beta 2b 66.67(n)
    65.11(a)
      100037315  NM_001089471.1  NP_001082940.1 


    ENSEMBL Gene Tree for ADRB2 (if available)
    TreeFam Gene Tree for ADRB2 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for ADRB2 gene
    TAAR62  HTR2A2  HTR62  TAAR22  ADRB12  TAAR82  HRH22  HTR2B2  
    DRD12  HTR2C2  TAAR12  HTR42  DRD52  ADRB32  TAAR52  
    18/30 SIMAP similar genes for ADRB2 using alignment to 2 protein entries:     ADRB2_HUMAN (see all proteins) (see all similar genes):
    5-HT7    ADRB1    ADRB3    DRD1    CHRM5    hA2aR
    DRD5    HRH3    HRH2    HTR4    TAAR1    TAAR9
    DRD5P1    HTR1D    HTR4B    TAAR8    ADRA1A    ADRA2C

    ADRB2 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    UniProtKB/Swiss-Prot: ADRB2_HUMAN, P07550
    Polymorphism: The Gly-16 allele is overrepresented in individuals affected by nocturnal asthma as compared to controls,
    and appears to be an important genetic factor in the expression of this asthmatic phenotype


    10/150 NCBI SNPs in ADRB2 are shown (see all 150    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 5 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs18008881,2
    C,F,Hdrug-response157211008(+) CCTTAC/TCTCCT 2 T I mis1 trp318Minor allele frequency- T:0.01NS EA NA EU 12345
    rs351407761,2
    C--143351252(+) AAGATC/TTTACT 1 -- us2k14Minor allele frequency- T:0.00NS 1558
    rs343605281,2
    C--143351337(+) AGATGG/AAGTCT 1 -- us2k13Minor allele frequency- A:0.00NS 1066
    rs349275471,2
    C--143351707(+) ATTGGG/TTTTAC 1 -- us2k13Minor allele frequency- T:0.01NS NA 96
    rs413710441,2
    C,F--143352095(+) CAGATG/AGAGAC 1 -- us2k11Minor allele frequency- A:0.00--980
    rs172874601,2
    C,F--143352281(+) CATGTC/AGGTGA 1 -- us2k1 ese32Minor allele frequency- A:0.00--6390
    rs173342281,2
    C,F--143352584(+) TGGCCC/TGCCCT 1 -- us2k1 ese310Minor allele frequency- T:0.03NS MN WA 7463
    rs344322111,2
    F--143352585(+) GGCCCGCCCTCCAGGGAG
    CAGTTGGGCCCC
    /-
    CCCTC
    1 -- us2k11Minor allele frequency- -:0.01--592
    rs456304601,2
    F--143352613(+) CCGCC-/CTCCAGGGAGCA
    GTTGGGCCCCGCCC
    GGGCC
    1 -- us2k11Minor allele frequency- CTCCAGGGAGCAGTTGGGCCCCGCCC:0.01--964
    rs353722441,2
    C--143352713(+) GTTCCC/TGTACG 1 -- us2k12Minor allele frequency- T:0.01NS 92

    HapMap Linkage Disequilibrium report for ADRB2 (148206156 - 148208197 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
          Database of Genomic Variants (DGV) variations for ADRB2: --
    Human Gene Mutation Database (HGMD): ADRB2

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ADRB2
    DNA2.0 Custom Variant and Variant Library Synthesis for ADRB2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    ADRB2 for disorders           About GeneDecksing

    OMIM gene information: 109690   
    OMIM disorders: 600807  601665  
    20/157 diseases for ADRB2 (see all 157):    About MalaCards
    beta-2-adrenoreceptor agonist, reduced response to (3) 18    open-angle glaucoma    asthma    resting heart rate
    attention deficit hyperactivity disorder    obesity    spinal cord injury    thyrotoxic periodic paralysis
    status asthmaticus    primary open angle glaucoma    congenital aortic valve stenosis    complex regional pain syndrome
    acute mountain sickness    patent ductus arteriosus    acanthosis nigricans    adult respiratory distress syndrome
    myasthenia gravis    aortic valve stenosis    long qt syndrome    asthma, nocturnal

    3 diseases from the University of Copenhagen DISEASES database for ADRB2:
    Asthma     Hypertension     Heart disease

    10/93 Novoseek disease relationships for ADRB2 gene (see all 93)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    asthma 68.9 256 18156033 (5), 16357573 (5), 10374285 (5), 15153795 (5) (see all 99)
    status asthmaticus 42.2 4 16395068 (3), 12628991 (1)
    heart failure 39.4 22 17117186 (2), 11208703 (1), 14573333 (1), 18353108 (1) (see all 21)
    obesity 39.2 73 11288039 (5), 19779622 (5), 17907319 (3), 11016907 (3) (see all 31)
    essential hypertension 39 28 17963627 (2), 12361188 (2), 10981553 (2), 19102885 (2) (see all 13)
    cholera 36.7 4 10822171 (2), 10473590 (1), 17008315 (1)
    atopy 29 1 11941312 (1)
    pulmonary disease chronic obstructive 25.8 13 16463710 (1), 16861834 (1), 18667995 (1), 19293197 (1) (see all 11)
    lung diseases obstructive 25.4 2 19706446 (1), 18024720 (1)
    heart failure congestive 20.8 10 17361123 (3), 9788966 (1), 17336757 (1), 11392464 (1) (see all 7)

    Genetic Association Database (GAD): ADRB2
    Human Genome Epidemiology (HuGE) Navigator: ADRB2 (507 documents)

    Export disorders for ADRB2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for ADRB2 gene, integrated from 9 sources (see all 1621):
    (articles sorted by number of sources associating them with ADRB2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Genetic polymorphisms of the beta 2-adrenergic receptor in nocturnal and nonnocturnal asthma. Evidence that Gly16 correlates with the nocturnal phenotype. (PubMed id 7706471)1, 2, 4, 9 Turki J.... Liggett S.B. (1995)
    2. Mutations in the gene encoding for the beta 2-adrenergic receptor in normal and asthmatic subjects. (PubMed id 8383511)1, 2, 4, 9 Reihsaus E.... Liggett S.B. (1993)
    3. [Beta 2-adrenoceptor polymorphism and effects of inhaled beta 2-stimulant (procaterol) and an anti-cholinergic drug (oxitropium) on the airway resistance] (PubMed id 15069780)1, 4, 7 Yamasaki Y....Ueda N. (2004)
    4. [beta 2-adrenoceptor polymorphism and effect of inhaled beta 2-stimulant (procaterol) on airway resistance measured by body plethysmography in healthy volunteers] (PubMed id 12428391)1, 4, 7 Kobayashi M....Taguchi H. (2002)
    5. ADRB2 polymorphisms and asthma susceptibility: transmission disequilibrium test and meta-analysis. (PubMed id 15153795)1, 4, 9 Migita O....Arinami T. (2004)
    6. Polymorphisms of IL4, IL13, and ADRB2 genes in COPD. (PubMed id 15596681)1, 4, 9 Hegab A.E....Sekizawa K. (2004)
    7. Possible association of beta2- and beta3-adrenergic receptor gene polymorphisms with susceptibility to breast cancer. (PubMed id 11434877)1, 4, 9 Huang X.E....Tajima K. (2001)
    8. Gln27Glu variant of the beta2-adrenergic receptor gene is not associated with obesity and diabetes in Japanese-Americans. (PubMed id 11288039)1, 4, 9 Kawamura T....Okubo M. (2001)
    9. Pharmacogenetic differences in response to albuterol between Puerto Ricans and Mexicans with asthma. (PubMed id 15557128)1, 7, 9 Choudhry S....Burchard E.G. (2005)
    10. [The genotype analysis of beta adrenergic receptor gene family in high risk population of hypertension in northeast China] (PubMed id 15079793)1, 4, 9 Liang Y....Shi J.P. (2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 154 HGNC: 286 AceView: ADRB2 Ensembl:ENSG00000169252 euGenes: HUgn154
    ECgene: ADRB2 Kegg: 154 H-InvDB: ADRB2

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for ADRB2 Pharmacogenomics, SNPs, Pathways
    GeneReviewshttp://www.ncbi.nlm.nih.gov/sites/GeneTests/lab/gene/ADRB2
    SeattleSNPshttp://pga.gs.washington.edu/data/adrb2/

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for ADRB2 gene:
    Search GeneIP for patents involving ADRB2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
    About This Section

     Browse for Gene Knock-down Tools from EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of ADRB2
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     Browse Small Molecules at EMD Millipore
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for ADRB2   OriGene shRNA RFP for ADRB2  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ADRB2   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ADRB2  
     OriGene Protein Over-expression Lysate for ADRB2   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for ADRB2   OriGene 3'-UTR Clone for ADRB2  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ADRB2   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ADRB2  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ADRB2   OriGene Custom Protein Services for ADRB2  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ADRB2
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ADRB2
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ADRB2
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ADRB2
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ADRB2
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ADRB2
     GenScript Custom Purified and Recombinant Proteins Services for ADRB2 GenScript cDNA clones with any tag delivered in your preferred vector for ADRB2
     GenScript ADRB2-overexpressing Cell Line for Assay GenScript Custom Superior Antibodies Services for ADRB2
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Antibodies & Assays for ADRB2 

     Regulatory tfbs in ADRB2 promoter
     Search Chromatin IP Primers for ADRB2
     RT2 qPCR Primer Assay in human, mouse, rat ADRB2
     GNC Network for ADRB2
     SABiosciences PCR Arrays including human, mouse, rat ADRB2
     Tocris compounds for ADRB2
     Browse Sino Biological Proteins and Antibodies
     cDNA Clones for ADRB2
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     ADRB2 antibodies
     ADRB2 proteins
     ADRB2 lysates
     Antibodies for ADRB2
     See all of Abcam's Antibodies, Kits and Proteins for ADRB2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Browse ELISAs, CLIAs, Proteins, and Antibodies at Uscn
     Search LifeMap BioReagents cell lines for ADRB2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ADRB2
     SwitchGear 3'UTR luciferase reporter plasmids for ADRB2
     SwitchGear Promoter luciferase reporter plasmids for ADRB2
     ThermoFisher Antibodies for ADRB2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ADRB2
     inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for ADRB2
    Sirion Biotech Customized:
     stable knockdown cell line services for ADRB2
     inducible knockdown cell line services for ADRB2
     design and validation of potent shRNA sequences against ADRB2
     adenovirus for potent knockdown of ADRB2
     adenovirus for overexpression of ADRB2
     stable overexpressing cell line services for ADRB2
     inducible overexpressing cell line services for ADRB2
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 13 May 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ADRB2 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4