Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ADPGK-AS1 Gene

Subcategory (RNA class) for ADPGK-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for ADPGK-AS1 Gene

  • ADPGK Antisense RNA 1 2 3
  • ADPGK Antisense RNA 1 (Non-Protein Coding) 2

External Ids for ADPGK-AS1 Gene

Previous GeneCards Identifiers for ADPGK-AS1 Gene

  • GC15P073075

Summaries for ADPGK-AS1 Gene

GeneCards Summary for ADPGK-AS1 Gene

ADPGK-AS1 (ADPGK Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ADPGK-AS1 Gene

Genomics for ADPGK-AS1 Gene

Genomic Location for ADPGK-AS1 Gene

Chromosome:
15
Start:
72,782,835 bp from pter
End:
72,798,199 bp from pter
Size:
15,365 bases
Orientation:
Plus strand

Genomic View for ADPGK-AS1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for ADPGK-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ADPGK-AS1 Gene

No data available for Regulatory Elements for ADPGK-AS1 Gene

Proteins for ADPGK-AS1 Gene

Post-translational modifications for ADPGK-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for ADPGK-AS1 Gene

Domains & Families for ADPGK-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for ADPGK-AS1 Gene

Function for ADPGK-AS1 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for ADPGK-AS1 Gene

Localization for ADPGK-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for ADPGK-AS1 Gene

Pathways & Interactions for ADPGK-AS1 Gene

SuperPathways for ADPGK-AS1 Gene

No Data Available

Interacting Proteins for ADPGK-AS1 Gene

Gene Ontology (GO) - Biological Process for ADPGK-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for ADPGK-AS1 Gene

Drugs & Compounds for ADPGK-AS1 Gene

No Compound Related Data Available

Transcripts for ADPGK-AS1 Gene

mRNA/cDNA for ADPGK-AS1 Gene

(3) Additional mRNA sequences :
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for ADPGK-AS1 Gene

ADPGK antisense RNA 1:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for ADPGK-AS1 Gene

No ASD Table

Relevant External Links for ADPGK-AS1 Gene

GeneLoc Exon Structure for
ADPGK-AS1
ECgene alternative splicing isoforms for
ADPGK-AS1

Expression for ADPGK-AS1 Gene

mRNA expression in normal human tissues for ADPGK-AS1 Gene

SOURCE GeneReport for Unigene cluster for ADPGK-AS1 Gene Hs.562587

genes like me logo Genes that share expression patterns with ADPGK-AS1: view

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for ADPGK-AS1 Gene

Orthologs for ADPGK-AS1 Gene

Evolution for ADPGK-AS1 Gene

ENSEMBL:
Gene Tree for ADPGK-AS1 (if available)
TreeFam:
Gene Tree for ADPGK-AS1 (if available)

No data available for Orthologs for ADPGK-AS1 Gene

Paralogs for ADPGK-AS1 Gene

No data available for Paralogs for ADPGK-AS1 Gene

Variants for ADPGK-AS1 Gene

Sequence variations from dbSNP and Humsavar for ADPGK-AS1 Gene

SNP ID Clin Chr 15 pos Sequence Context AA Info Type MAF
rs572732336 -- 72,790,580(+) GAACT(C/T)CCCAA intron-variant
rs573013623 -- 72,796,496(+) CTCCT(G/T)TAAAG intron-variant
rs573262758 -- 72,786,211(+) CTGTA(C/G/T)GAACA intron-variant
rs573270827 -- 72,790,804(+) CCTGA(-/GTTGTTGCCAGTTTTGGGCAATTG)GTTGT intron-variant
rs573494158 -- 72,790,409(+) ATGGA(A/G)TCATA intron-variant

Relevant External Links for ADPGK-AS1 Gene

HapMap Linkage Disequilibrium report
ADPGK-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for ADPGK-AS1 Gene

Disorders for ADPGK-AS1 Gene

Relevant External Links for ADPGK-AS1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
ADPGK-AS1
genes like me logo Genes that share disorders with ADPGK-AS1: view

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for ADPGK-AS1 Gene

Publications for ADPGK-AS1 Gene

  1. Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (PMID: 23263486) KAPttgen A. … Gieger C. (Nat. Genet. 2013) 67

Products for ADPGK-AS1 Gene

Sources for ADPGK-AS1 Gene

Back to Top

Content