Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ADARB2-AS1 Gene

Subcategory (RNA class) for ADARB2-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for ADARB2-AS1 Gene

  • ADARB2 Antisense RNA 1 2 3 4 5
  • ADARB2 Antisense RNA 1 (Non-Protein Coding) 2 3
  • NCRNA00168 3 4
  • C10orf109 3 4
  • Chromosome 10 Open Reading Frame 109 2
  • ADARB2 Antisense Gene Protein 1 4
  • Non-Protein Coding RNA 168 2
  • BA466B20.1 3
  • HCG1773937 3

External Ids for ADARB2-AS1 Gene

Previous HGNC Symbols for ADARB2-AS1 Gene

  • C10orf109
  • NCRNA00168

Previous GeneCards Identifiers for ADARB2-AS1 Gene

  • GC10P001568

Summaries for ADARB2-AS1 Gene

GeneCards Summary for ADARB2-AS1 Gene

ADARB2-AS1 (ADARB2 Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ADARB2-AS1 Gene

Genomics for ADARB2-AS1 Gene

Regulatory Elements for ADARB2-AS1 Gene

Enhancers for ADARB2-AS1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH10F001498 1.3 FANTOM5 ENCODE 11.9 -27.1 -27126 1.6 PKNOX1 GLI4 FOS SP3 YY2 JUNB TSHZ1 ZNF488 ZNF623 ZNF658 ADARB2-AS1 ADARB2 WDR37 GC10P001430
GH10F001501 0.2 ENCODE 11.9 -24.1 -24093 1.2 ADARB2-AS1 GC10P001430
GH10F001488 1.2 FANTOM5 Ensembl ENCODE 0.3 -37.3 -37330 1.0 HDGF USF1 BHLHE40 USF2 ZBTB40 GABPA RAD51 GATA3 POLR2A EED ADARB2-AS1 GC10P001430
GH10F001454 1 Ensembl ENCODE 0.2 -71.9 -71900 1.0 MXI1 YBX1 BMI1 EBF1 CTBP1 EED ETV6 CHD2 MTA2 BHLHE40 GC10P001430 ADARB2-AS1
GH10F001465 1 Ensembl ENCODE 0.2 -60.7 -60662 1.6 HDGF ESRRA USF1 KLF17 EBF1 ZIC2 ZFHX2 GLIS2 FOS ZNF263 GC10P001430 ADARB2-AS1
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around ADARB2-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Location for ADARB2-AS1 Gene

Chromosome:
10
Start:
1,526,630 bp from pter
End:
1,556,984 bp from pter
Size:
30,355 bases
Orientation:
Plus strand

Genomic View for ADARB2-AS1 Gene

Genes around ADARB2-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ADARB2-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ADARB2-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ADARB2-AS1 Gene

Proteins for ADARB2-AS1 Gene

  • Protein details for ADARB2-AS1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    A8MUL3-ADAS1_HUMAN
    Recommended name:
    Putative uncharacterized protein ADARB2-AS1
    Protein Accession:
    A8MUL3

    Protein attributes for ADARB2-AS1 Gene

    Size:
    147 amino acids
    Molecular mass:
    15836 Da
    Quaternary structure:
    No Data Available

neXtProt entry for ADARB2-AS1 Gene

Post-translational modifications for ADARB2-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for ADARB2-AS1 Gene

Domains & Families for ADARB2-AS1 Gene

Protein Domains for ADARB2-AS1 Gene

ProtoNet:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ADARB2-AS1: view

No data available for Gene Families , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for ADARB2-AS1 Gene

Function for ADARB2-AS1 Gene

Phenotypes for ADARB2-AS1 Gene

GenomeRNAi human phenotypes for ADARB2-AS1:
genes like me logo Genes that share phenotypes with ADARB2-AS1: view

Animal Model Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for ADARB2-AS1 Gene

Localization for ADARB2-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for ADARB2-AS1 Gene

Pathways & Interactions for ADARB2-AS1 Gene

SuperPathways for ADARB2-AS1 Gene

No Data Available

Interacting Proteins for ADARB2-AS1 Gene

Gene Ontology (GO) - Biological Process for ADARB2-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for ADARB2-AS1 Gene

Transcripts for ADARB2-AS1 Gene

mRNA/cDNA for ADARB2-AS1 Gene

(1) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for ADARB2-AS1 Gene

ADARB2 antisense RNA 1:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for ADARB2-AS1 Gene

No ASD Table

Relevant External Links for ADARB2-AS1 Gene

GeneLoc Exon Structure for
ADARB2-AS1
ECgene alternative splicing isoforms for
ADARB2-AS1

Expression for ADARB2-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for ADARB2-AS1 Gene

mRNA differential expression in normal tissues according to GTEx for ADARB2-AS1 Gene

This gene is overexpressed in Brain - Spinal cord (cervical c-1) (x17.0), Brain - Substantia nigra (x12.4), and Brain - Hypothalamus (x4.7).

SOURCE GeneReport for Unigene cluster for ADARB2-AS1 Gene:

Hs.568831
genes like me logo Genes that share expression patterns with ADARB2-AS1: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for ADARB2-AS1 Gene

Orthologs for ADARB2-AS1 Gene

Evolution for ADARB2-AS1 Gene

ENSEMBL:
Gene Tree for ADARB2-AS1 (if available)
TreeFam:
Gene Tree for ADARB2-AS1 (if available)

No data available for Orthologs for ADARB2-AS1 Gene

Paralogs for ADARB2-AS1 Gene

No data available for Paralogs for ADARB2-AS1 Gene

Variants for ADARB2-AS1 Gene

Sequence variations from dbSNP and Humsavar for ADARB2-AS1 Gene

SNP ID Clin Chr 10 pos Sequence Context AA Info Type
rs10523350 -- 1,544,985(+) ACACA(-/CACACACACACAC/CACACACACACACAC)ATGTC intron-variant
rs10526252 -- 1,544,956(+) AGTAT(-/ACAC/ACACACACACACACACAC/ATAC/ATACAC/ATACACACAC/ATACACACACACACACAC/ATACACACACACACACACACAC)ACACA intron-variant
rs10642770 -- 1,557,241(+) ACCTC(-/TT)GTCTG intron-variant
rs10665623 -- 1,552,924(+) AATTC(-/ATTT)GTTTA intron-variant
rs10706282 -- 1,557,136(+) CCCCC(-/C)GTCTT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for ADARB2-AS1 Gene

Variant ID Type Subtype PubMed ID
nsv951234 CNV deletion 24416366
nsv821076 CNV deletion 20802225
nsv549792 CNV loss 21841781
nsv512138 CNV loss 21212237
nsv24360 CNV deletion 16902084
nsv1054555 CNV gain 25217958
nsv1046041 CNV gain 25217958
nsv1041498 CNV gain 25217958
esv991990 CNV deletion 20482838
esv2730151 CNV deletion 23290073
esv2730140 CNV deletion 23290073
esv2730128 CNV deletion 23290073
esv2730117 CNV deletion 23290073
esv2730106 CNV deletion 23290073
esv2730084 CNV deletion 23290073
esv2730073 CNV deletion 23290073
esv2730062 CNV deletion 23290073
esv2730051 CNV deletion 23290073
esv2730040 CNV deletion 23290073
esv23632 CNV loss 19812545
esv1761080 CNV deletion 17803354
esv1608725 CNV deletion 17803354
esv1588804 CNV deletion 17803354
esv1522620 CNV deletion 17803354
esv1416852 CNV deletion 17803354
esv1269144 CNV deletion 17803354
dgv925n54 CNV gain 21841781
dgv78e201 CNV deletion 23290073
dgv337n106 CNV deletion 24896259

Relevant External Links for ADARB2-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
ADARB2-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for ADARB2-AS1 Gene

Disorders for ADARB2-AS1 Gene

Relevant External Links for ADARB2-AS1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
ADARB2-AS1

No disorders were found for ADARB2-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for ADARB2-AS1 Gene

Publications for ADARB2-AS1 Gene

  1. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K. … Sugano S. (Genome Res. 2006) 3 64
  2. The DNA sequence and comparative analysis of human chromosome 10. (PMID: 15164054) Deloukas P. … Rogers J. (Nature 2004) 4 64
  3. The sequence of the human genome. (PMID: 11181995) Venter J.C. … Zhu X. (Science 2001) 3 64

Products for ADARB2-AS1 Gene

Sources for ADARB2-AS1 Gene

Content
Loading form....