Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



ADARB1 Gene

protein-coding   GIFtS: 63
GCID: GC21P046493

Adenosine Deaminase, RNA-Specific, B1

(Previous names: adenosine deaminase, RNA-specific, B1 (homolog of rat RED1))
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, 15RNAdb, and/or 11Nature:405,311-319 and CroW21)
About This Section

TryGeneCards Plus

Aliases
Adenosine Deaminase, RNA-Specific, B11 2     DRABA22
RED12 3 5     Adenosine Deaminase, RNA-Specific, B1 (RED1 Homolog Rat)2
Adenosine Deaminase, RNA-Specific, B1 (Homolog Of Rat RED1)1 2     Double-Stranded RNA-Specific Editase 12
ADAR22 3     DsRNA Adenosine Deaminase DRADA22
DRADA22 3     RED1 Homolog2
RNA-Editing Deaminase 12 3     RNA Editase2
RNA-Editing Enzyme 12 3     RNA Editing Deaminase 12
RED1 Homolog (Rat)1     EC 3.5.4.373
Human DsRNA Adenosine Deaminase DRADA2b, EC 3.511     DsRNA Adenosine Deaminase3

External Ids:    HGNC: 2261   Entrez Gene: 1042   Ensembl: ENSG000001973817   OMIM: 6012185   UniProtKB: P785633   

Export aliases for ADARB1 gene to outside databases

Previous GC identifers: GC21P043004 GC21P045351 GC21P045350 GC21P045318 GC21P031920


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for ADARB1 Gene:
This gene encodes the enzyme responsible for pre-mRNA editing of the glutamate receptor subunit B by site-specific
deamination of adenosines. Studies in rat found that this enzyme acted on its own pre-mRNA molecules to convert
an AA dinucleotide to an AI dinucleotide which resulted in a new splice site. Alternative splicing of this gene
results in several transcript variants, some of which have been characterized by the presence or absence of an
ALU cassette insert and a short or long C-terminal region. (provided by RefSeq, Jul 2008)

GeneCards Summary for ADARB1 Gene:
ADARB1 (adenosine deaminase, RNA-specific, B1) is a protein-coding gene. Diseases associated with ADARB1 include alk-negative anaplastic large cell lymphoma, and anaplastic large cell lymphoma. GO annotations related to this gene include double-stranded RNA binding and RNA binding. An important paralog of this gene is ADAR.

UniProtKB/Swiss-Prot: RED1_HUMAN, P78563
Function: Catalyzes the hydrolytic deamination of adenosine to inosine in double-stranded RNA (dsRNA) referred to
as A-to-I RNA editing. This may affect gene expression and function in a number of ways that include mRNA
translation by changing codons and hence the amino acid sequence of proteins; pre-mRNA splicing by altering
splice site recognition sequences; RNA stability by changing sequences involved in nuclease recognition; genetic
stability in the case of RNA virus genomes by changing sequences during viral RNA replication; and RNA
structure-dependent activities such as microRNA production or targeting or protein-RNA interactions. Can edit
both viral and cellular RNAs and can edit RNAs at multiple sites (hyper-editing) or at specific sites
(site-specific editing). Its cellular RNA substrates include: bladder cancer-associated protein (BLCAP),
neurotransmitter receptors for glutamate (GRIA2 and GRIK2) and serotonin (HTR2C), GABA receptor (GABRA3) and
potassium voltage-gated channel (KCNA1). Site-specific RNA editing of transcripts encoding these proteins results
in amino acid substitutions which consequently alter their functional activities. Edits GRIA2 at both the Q/R and
R/G sites efficiently but converts the adenosine in hotspot1 much less efficiently. Can exert a proviral effect
towards human immunodeficiency virus type 1 (HIV-1) and enhances its replication via both an editing-dependent
and editing-independent mechanism. The former involves editing of adenosines in the 5'UTR while the latter occurs
via suppression of EIF2AK2/PKR activation and function. Can inhibit cell proliferation and migration and can
stimulate exocytosis

Gene Wiki entry for ADARB1 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics, Whole Chromsome Sequence According to Nature (Cited Here with Permission):405,311-319 and CroW21)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000021.9  NT_011512.12  NC_018932.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the ADARB1 gene promoter:
         CREB   p53   deltaCREB   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidADARB1 promoter sequence

   Search Chromatin IP Primers for ADARB1

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ADARB1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 21q22.3   Ensembl cytogenetic band:  21q22.3   HGNC cytogenetic band: 21q22.3
Nature(405: 311-319) cytogenetic band:   21q22.3
ADARB1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ADARB1 gene location
GeneLoc information about chromosome 21         GeneLoc Exon Structure

(about GC identifiers)
GC21P046493:   GeneLoc Nature:405,311-319
Start:
46,493,768 bp from pter       32,003,926 bp from centromere
End:
46,646,478 bp from pter 32,155,953 bp from centromere
Size:
152,711 bases 152,028 bases
Orientation:
plus strand plus strand

Whole chromosome sequencing:
cDNA sequence: U76421
genomic clones: R774F24 to Q26C4


(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: RED1_HUMAN, P78563 (See protein sequence)
Recommended Name: Double-stranded RNA-specific editase 1  
Size: 741 amino acids; 80763 Da
Cofactor: Binds 1 inositol hexakisphosphate (IP6) per subunit
Subunit: Homodimer. Homodimerization is essential for its catalytic activity. Can form heterodimers with isoform 5
of ADAR/ADAR1
1 PDB 3D structure from and Proteopedia for ADARB1:
1ZY7 (3D)    
Secondary accessions: A6NFK8 A6NJ84 C3TTQ1 O00395 O00465 O00691 O00692 P78555 Q4AE79 Q8NFD1
Alternative splicing: 5 isoforms:  P78563-1   P78563-2   P78563-3   P78563-4   P78563-5   (Incomplete sequence. Alternative 5'exon)

Explore the universe of human proteins at neXtProt for ADARB1: NX_P78563

Explore proteomics data for ADARB1 at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See ADARB1 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (4 alternative transcripts): 
    NP_001103.1  NP_001153702.1  NP_056648.1  NP_056649.1  

    ENSEMBL proteins: 
     ENSP00000374511   ENSP00000436367   ENSP00000435381   ENSP00000374513   ENSP00000015877  
     ENSP00000387480   ENSP00000353920   ENSP00000441897   ENSP00000414600  
    Reactome Protein details: P78563

    ADARB1 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for ADARB1
    OriGene Protein Over-expression Lysate for ADARB1
    OriGene MassSpec for ADARB1
    OriGene Custom Protein Services for ADARB1
    GenScript Custom Purified and Recombinant Proteins Services for ADARB1
    Novus Biologicals ADARB1 Proteins
    Novus Biologicals ADARB1 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for ADARB1

    ADARB1 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for ADARB1
    OriGene Custom Antibody Services for ADARB1
    Novus Biologicals ADARB1 Antibodies
    Abcam antibodies for ADARB1
    Cloud-Clone Corp. Antibodies for ADARB1
    Search ThermoFisher Antibodies for ADARB1
    LSBio Antibodies in human, mouse, rat for ADARB1

    ADARB1 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for ADARB1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ADARB1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for ADARB1
    Cloud-Clone Corp. CLIAs for ADARB1


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    3 InterPro protein domains:
     IPR002466 A_deamin
     IPR014720 dsRNA-bd_dom
     IPR008996 Cytokine_IL1-like

    Graphical View of Domain Structure for InterPro Entry P78563

    ProtoNet protein and cluster: P78563

    2 Blocks protein domains:
    IPB001159 Double-stranded RNA binding (DsRBD) domain
    IPB002466 Adenosine deaminase/editase


    UniProtKB/Swiss-Prot: RED1_HUMAN, P78563
    Similarity: Contains 1 A to I editase domain
    Similarity: Contains 2 DRBM (double-stranded RNA-binding) domains


    ADARB1 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: RED1_HUMAN, P78563
    Function: Catalyzes the hydrolytic deamination of adenosine to inosine in double-stranded RNA (dsRNA) referred to
    as A-to-I RNA editing. This may affect gene expression and function in a number of ways that include mRNA
    translation by changing codons and hence the amino acid sequence of proteins; pre-mRNA splicing by altering
    splice site recognition sequences; RNA stability by changing sequences involved in nuclease recognition; genetic
    stability in the case of RNA virus genomes by changing sequences during viral RNA replication; and RNA
    structure-dependent activities such as microRNA production or targeting or protein-RNA interactions. Can edit
    both viral and cellular RNAs and can edit RNAs at multiple sites (hyper-editing) or at specific sites
    (site-specific editing). Its cellular RNA substrates include: bladder cancer-associated protein (BLCAP),
    neurotransmitter receptors for glutamate (GRIA2 and GRIK2) and serotonin (HTR2C), GABA receptor (GABRA3) and
    potassium voltage-gated channel (KCNA1). Site-specific RNA editing of transcripts encoding these proteins results
    in amino acid substitutions which consequently alter their functional activities. Edits GRIA2 at both the Q/R and
    R/G sites efficiently but converts the adenosine in hotspot1 much less efficiently. Can exert a proviral effect
    towards human immunodeficiency virus type 1 (HIV-1) and enhances its replication via both an editing-dependent
    and editing-independent mechanism. The former involves editing of adenosines in the 5'UTR while the latter occurs
    via suppression of EIF2AK2/PKR activation and function. Can inhibit cell proliferation and migration and can
    stimulate exocytosis
    Catalytic activity: Adenine in double-stranded RNA + H(2)O = hypoxanthine in double-stranded RNA + NH(3)

         Enzyme Number (IUBMB): EC 3.5.4.371

         Gene Ontology (GO): Selected molecular function terms (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003723RNA binding IDA9111310
    GO:0003725double-stranded RNA binding IDA8995285
    GO:0003726double-stranded RNA adenosine deaminase activity IDA8995285
    GO:0003729mRNA binding TAS9149227
    GO:0004000adenosine deaminase activity IEA--
         
    ADARB1 for ontologies           About GeneDecksing


    Phenotypes:
         7 MGI mutant phenotypes (inferred from 4 alleles(MGI details for Adarb1):
     behavior/neurological  growth/size/body  mortality/aging  muscle  nervous system 
     no phenotypic analysis  normal 

    ADARB1 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-outs for ADARB1: Adarb1tm1.1Eme Adarb1tm1Phs

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ADARB1
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ADARB1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for ADARB1
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for ADARB1

    miRNA
    Products:
        
    miRTarBase miRNAs that target ADARB1:
    hsa-mir-34a-5p (MIRT025443), hsa-mir-148a-3p (MIRT025977), hsa-mir-93-5p (MIRT027945), hsa-mir-124-3p (MIRT022259), hsa-mir-193b-3p (MIRT041526), hsa-mir-26b-5p (MIRT029036), hsa-mir-17-5p (MIRT050812), hsa-mir-130b-3p (MIRT020174)

    Block miRNA regulation of human, mouse, rat ADARB1 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate ADARB1 (see all 53):
    hsa-miR-548j hsa-miR-3685 hsa-miR-631 hsa-miR-146a hsa-miR-4272 hsa-miR-199a-3p hsa-miR-138-2* hsa-miR-218
    SwitchGear 3'UTR luciferase reporter plasmidADARB1 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for ADARB1
    Predesigned siRNA for gene silencing in human, mouse, rat ADARB1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ADARB1

    Clone
    Products:
         
    OriGene clones in human, mouse for ADARB1 (see all 24)
    OriGene ORF clones in mouse, rat for ADARB1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 4): ADARB1 (NM_001112)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ADARB1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ADARB1

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ADARB1
    Browse ESI BIO Cell Lines and PureStem Progenitors for ADARB1 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ADARB1


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    RED1_HUMAN, P78563: Nucleus. Nucleus, nucleolus. Note=Shuttles between nucleoli and the nucleoplasm
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    nucleus5
    cytosol1
    mitochondrion1

    Gene Ontology (GO): 3 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IDA8995285
    GO:0005654nucleoplasm TAS--
    GO:0005730nucleolus IDA18178553

    ADARB1 for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for ADARB1 About    
    See pathways by source

    SuperPathContained pathways About
    1Formation of editosomes by ADAR proteins
    Formation of editosomes by ADAR proteins0.50
    mRNA Editing- A to I Conversion0.00
    mRNA Editing0.50
    C6 deamination of adenosine0.00
    2Gene Expression
    Gene Expression0.40
    3Purine metabolism (KEGG)
    ATP ITP metabolism0.31

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    1 GeneGo (Thomson Reuters) Pathway for ADARB1
        ATP/ITP metabolism

    2 Reactome Pathways for ADARB1
        C6 deamination of adenosine
    Formation of editosomes by ADAR proteins



    ADARB1 for pathways           About GeneDecksing

        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for ADARB1
    Interactions:

        GeneGlobe Interaction Network for ADARB1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 12)

    Selected Interacting proteins for ADARB1 (P785631, 2, 3 ENSP000003539204) via UniProtKB, MINT, STRING, and/or I2D (see all 12)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    PIN1Q135261, 2, 3, ENSP000002479704EBI-2967304,EBI-714158 MINT-8298746 MINT-8299062 MINT-8299112 MINT-8298729 MINT-8299021 MINT-8299182 MINT-8299087 MINT-8298958 MINT-8299154 MINT-8299198 MINT-8299034 MINT-8298987 I2D: score=1 STRING: ENSP00000247970
    WWP2O003081, 2, 3, ENSP000003482834EBI-2967304,EBI-743923 MINT-8299276 MINT-8299218 MINT-8299255 MINT-8299302 MINT-8299234 I2D: score=1 STRING: ENSP00000348283
    MAP1LC3AQ9H4923, ENSP000003639704I2D: score=1 STRING: ENSP00000363970
    PPP2CBP627143, ENSP000002211384I2D: score=1 STRING: ENSP00000221138
    PSMA2ENSP000002233214STRING: ENSP00000223321
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 13):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006382adenosine to inosine editing TAS--
    GO:0006396RNA processing IDA9149227
    GO:0006397mRNA processing IEA--
    GO:0008285negative regulation of cell proliferation IDA18178553
    GO:0010467gene expression TAS--

    ADARB1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for ADARB1 (RED1)

    6 Novoseek inferred chemical compound relationships for ADARB1 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    red 2 93.9 3 10854777 (2), 10581403 (1)
    inosine 87.2 9 9614652 (1), 16257978 (1), 12665561 (1), 10376681 (1) (see all 8)
    glutamate 57.4 10 9143496 (3), 12459255 (1), 10581403 (1), 10854777 (1) (see all 7)
    cytidine 37.1 1 10376681 (1)
    arginine 35.1 3 19447293 (2), 9570943 (1)
    glutamine 34.7 2 19447293 (2)



    ADARB1 for compounds           About GeneDecksing



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for ADARB1 gene (5 alternative transcripts): 
    NM_001033049.1  NM_001112.3  NM_001160230.1  NM_015833.3  NM_015834.3  

    Unigene Cluster for ADARB1:

    Adenosine deaminase, RNA-specific, B1
    Hs.474018  [show with all ESTs]
    Unigene Representative Sequence: NM_015833
    13 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000462214 ENST00000460734(uc002zgp.2) ENST00000389861(uc002zgs.2)
    ENST00000492414 ENST00000496664 ENST00000389863(uc011afo.1) ENST00000348831
    ENST00000449478 ENST00000464215 ENST00000360697 ENST00000481022 ENST00000539173(uc002zgr.2 uc002zgq.2 uc002zgu.2 uc002zgy.2 uc002zgw.2 uc002zgv.2 uc002zgt.2 uc010gpx.2)
    ENST00000437626
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat ADARB1 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate ADARB1 (see all 53):
    hsa-miR-548j hsa-miR-3685 hsa-miR-631 hsa-miR-146a hsa-miR-4272 hsa-miR-199a-3p hsa-miR-138-2* hsa-miR-218
    SwitchGear 3'UTR luciferase reporter plasmidADARB1 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for ADARB1
    Predesigned siRNA for gene silencing in human, mouse, rat ADARB1
    Clone
    Products:
         
    OriGene clones in human, mouse for ADARB1 (see all 24)
    OriGene ORF clones in mouse, rat for ADARB1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 4): ADARB1 (NM_001112)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ADARB1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ADARB1
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for ADARB1
    OriGene qSTAR qPCR primer pairs in human, mouse for ADARB1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ADARB1
      QuantiTect SYBR Green Assays in human, mouse, rat ADARB1
      Search QuantiFast Probe-based Assays in human, mouse, rat ADARB1

    Additional mRNA sequence: 

    AB194369.1 AB194370.1 AB194371.1 AB194372.2 AB194373.1 AF001042.1 AF525422.1 AF533142.1 
    AK027227.1 AY135659.1 BC030663.1 BC046198.1 BC065545.1 FJ169506.1 NR_027672.1 NR_027673.1 
    NR_027674.1 NR_073200.1 U73197.1 U76420.1 U76421.1 U76422.1 U82120.1 U82121.1 
    X99227.1 X99383.1 

    21 DOTS entries:

    DT.100815682  DT.99943664  DT.100033794  DT.100815681  DT.121134249  DT.100815679  DT.455913  DT.100815678 
    DT.121134252  DT.121134268  DT.121134274  DT.97827563  DT.95334920  DT.95301641  DT.97820630  DT.121134237 
    DT.75169302  DT.95324847  DT.121134243  DT.427065  DT.97827562 

    Selected AceView cDNA sequences (see all 172):

    BE855417 X99227 AA736984 BE045989 U76421 CK822658 BQ437695 AA632253 
    AI523998 BM718313 CA420663 AA565144 H06849 BQ430112 AI356850 U76420 
    BF515374 AW103327 BC030663 AW298499 AA580169 BQ955425 AA312893 AI276615 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for ADARB1 (see all 14)    About this scheme

    ExUns: 1 ^ 2a · 2b ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b ^ 14a · 14b ^ 15 ^ 16 ^ 17 ^ 18 ^ 19a · 19b ^ 20 ^ 21 ^
    SP1:                    -     -     -     -           -     -     -     -     -     -                             -           -                                 
    SP2:                    -     -     -     -           -     -     -     -     -     -                             -           -                                 
    SP3:                    -     -     -     -           -     -           -     -     -                             -           -                       -         
    SP4:                    -     -     -     -           -     -     -     -     -     -                             -           -                       -         
    SP5:                    -     -     -     -           -     -     -     -     -     -                             -           -                       -         

    ExUns: 22 ^ 23 ^ 24 ^ 25a · 25b · 25c ^ 26a · 26b
    SP1:                    -     -     -               
    SP2:                                -               
    SP3:                                -               
    SP4:                    -     -     -               
    SP5:                                -               


    ECgene alternative splicing isoforms for ADARB1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    ADARB1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: AGACGCTGTC
    ADARB1 Expression
    About this image


    ADARB1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 4) fully expand
     
     Blood (Cardiovascular System)    fully expand to see all 3 entries
             Mature B-Cells Peripheral Blood
     
     Skeletal Muscle (Muscoskeletal System)    fully expand to see all 2 entries
             Myoblasts Mandibular Arch Muscles
     
     Thymus (Hematopoietic System)
             T Helper Cells Thymus
     
     Lung (Respiratory System)
    ADARB1 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    ADARB1 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.474018

    UniProtKB/Swiss-Prot: RED1_HUMAN, P78563
    Tissue specificity: Highly expressed in brain and heart and at lower levels in placenta. Fair expression in lung,
    liver and kidney. Detected in brain, heart, kidney, lung and liver (at protein level). Isoform 5 is high
    expressed in hippocampus and colon. Isoform 5 is expressed in pediatric astrocytomas and the protein has a
    decreased RNA-editing activity. The decrease in RNA editing correlates with the grade of malignancy of the
    tumors, with the high grade tumors showing lower editing is seen

        Custom PCR Arrays for ADARB1
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for ADARB1
    OriGene qSTAR qPCR primer pairs in human, mouse for ADARB1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ADARB1
    QuantiTect SYBR Green Assays in human, mouse, rat ADARB1
    Search QuantiFast Probe-based Assays in human, mouse, rat ADARB1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ADARB1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for ADARB1 gene from Selected species (see all 16)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Adarb11 , 5 adenosine deaminase, RNA-specific, B11, 5 87.73(n)1
    94.86(a)1
      10 (39.72 cM)5
    1105321  NM_001024837.21  NP_001020008.11 
     772907265 
    chicken
    (Gallus gallus)
    Aves ADARB11 adenosine deaminase, RNA-specific, B1 78.3(n)
    84.12(a)
      374087  NM_001111074.1  NP_001104544.1 
    lizard
    (Anolis carolinensis)
    Reptilia ADARB16
    adenosine deaminase, RNA-specific, B1
    83(a)
    1 ↔ 1
    4(90596958-90665709)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.238292 Xenopus laevis transcribed sequence with moderate similarity more 72.67(n)    BU911149.1 
    zebrafish
    (Danio rerio)
    Actinopterygii adarb12 adenosine deaminase, RNA-specific, B1 75.89(n)   58134  AF403110.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Adar1 , 3 adenosine to inosine editing
    double-stranded RNA more3
    Adenosine deaminase acting on RNA1
    44(a)3
    52.22(n)1
    49.67(a)1
      1 2B93
    311301  NM_001258545.11  NP_001245474.11 
    worm
    (Caenorhabditis elegans)
    Secernentea adr-13
    adr-21
    Expression: nervous system, vulva,
    gastrulating more3
    adr-21
    30(a)3
    42.87(n)1
    32.88(a)1
      III(7302919-7304628)3
    1760221  NM_066193.41  NP_498594.11 


    ENSEMBL Gene Tree for ADARB1 (if available)
    TreeFam Gene Tree for ADARB1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for ADARB1 gene
    ADAR2  ADAT12  ADARB22  ADAD22  ADAD12  
    5 SIMAP similar genes for ADARB1 using alignment to 5 protein entries:     RED1_HUMAN (see all proteins):
    ADAR2d    hRED1    RED1    ADARB2    ADAR

    ADARB1 for paralogs           About GeneDecksing


    1 Pseudogenes.org Pseudogene for ADARB1
    PGOHUM00000241434


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for ADARB1 (see all 3172)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 21 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs681564111,2
    C--37106386(+) GAATT-/GTTTTTT 5 -- int11Minor allele frequency- GT:0.00NA 2
    rs61475371,2
    C--46493977(+) GGGGC-/TCGGCGGGGGCTCGGCGGGGG
    CTCGGCGGGGGCTCGGCGGGGGC
    AGCGC
    8 -- us2k11Minor allele frequency- TCGGCGGGGGCTCGGCGGGGGCTCGGCGGGGGCTCGGCGGGGGC:0.00NA 2
    rs48190271,2
    C,F,A,H--46495224(+) ACGCTG/CCGCCC 8 -- int18Minor allele frequency- C:0.14NA WA CSA EA 367
    rs1436037941,2
    --46495247(+) TGCGCC/TGGGGG 8 -- int10--------
    rs72759311,2
    C,F--46496288(+) TGGTGG/CAGAGG 8 -- int13Minor allele frequency- C:0.08WA NA EA 358
    rs1808204051,2
    --46496306(+) CACACA/GGACTC 8 -- int10--------
    rs1856214491,2
    --46496585(+) AAAAAC/TATCTT 8 -- int10--------
    rs1510559981,2
    --46496730(+) ACAAAC/TACTTG 8 -- int10--------
    rs1169527151,2
    F--46496824(+) TGCTTC/TTGGCA 8 -- int11Minor allele frequency- T:0.01EA 120
    rs1413151561,2
    --46496836(+) AAAGCA/GGTACA 8 -- int10--------

    HapMap Linkage Disequilibrium report for ADARB1 (46493768 - 46646478 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for ADARB1 (see all 23):    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2723716CNV Deletion23290073
    esv2723714CNV Deletion23290073
    esv995257CNV Deletion20482838
    esv998882CNV Deletion20482838
    esv2723719CNV Deletion23290073
    esv2043847CNV Deletion18987734
    esv999386CNV Deletion20482838
    esv2213161CNV Deletion18987734
    esv1361921CNV Deletion17803354
    esv2723718CNV Deletion23290073

    Human Gene Mutation Database (HGMD): ADARB1
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing ADARB1
    DNA2.0 Custom Variant and Variant Library Synthesis for ADARB1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 601218    OMIM disorders: --

    Selected diseases for ADARB1 (see all 23):    
    About MalaCards
    alk-negative anaplastic large cell lymphoma    anaplastic large cell lymphoma    contact dermatitis    down syndrome
    acne    behcet's disease    pulmonary function    malignant glioma
    lateral sclerosis    amyotrophic lateral sclerosis    dermatitis    astrocytoma
    bipolar disorder    hodgkin's lymphoma    systemic lupus erythematosus    lupus erythematosus
    obesity    hiv-1    hepatitis    prostate cancer


    ADARB1 for disorders           About GeneDecksing

    6 Novoseek inferred disease relationships for ADARB1 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    hepatitis delta 53.5 2 11907222 (1), 8602246 (1)
    epilepsy 15.6 3 20424386 (1), 9143496 (1), 19156214 (1)
    genetic disorder 14 1 9143496 (1)
    bipolar disorder 12.8 2 9143496 (2)
    down syndrome 12.3 2 9330641 (1), 14757529 (1)
    neurological disorders 5.23 1 9143496 (1)

    Genetic Association Database (GAD): ADARB1
    Human Genome Epidemiology (HuGE) Navigator: ADARB1 (3 documents)

    Export disorders for ADARB1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for ADARB1 gene, integrated from 10 sources (see all 104):
    (articles sorted by number of sources associating them with ADARB1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Cloning of a human RNA editing deaminase (ADARB1) of glutamate receptors that maps to chromosome 21q22.3. (PubMed id 9143496)1, 2, 3, 9 Mittaz L....Antonarakis S.E. (Genomics 1997)
    2. Down-regulation of RNA editing in pediatric astrocytomas: ADAR2 editing activity inhibits cell migration and proliferation. (PubMed id 18178553)1, 2, 9 Cenci C.... Gallo A. (J. Biol. Chem. 2008)
    3. Novel exon of mammalian ADAR2 extends open reading frame. (PubMed id 19156214)1, 2, 9 Maas S. and Gommans W.M. (PLoS ONE 2009)
    4. Phylogenetic comparison of the pre-mRNA adenosine deaminase ADAR2 genes and transcripts: conservation and diversity in editing site sequence and alternative splicing patterns. (PubMed id 12459255)1, 2, 9 Slavov D. and Gardiner K. (Gene 2002)
    5. Novel splice variants of human ADAR2 mRNA: skipping of the exon encoding the dsRNA-binding domains, and multiple C-terminal splice sites. (PubMed id 16297572)1, 2, 9 Kawahara Y.... Kwak S. (Gene 2005)
    6. Two forms of human double-stranded RNA-specific editase 1 (hRED1) generated by the insertion of an Alu cassette. (PubMed id 9149227)1, 2, 9 Gerber A.... Keller W. (RNA 1997)
    7. Inositol hexakisphosphate is bound in the ADAR2 core and required for RNA editing. (PubMed id 16141067)1, 2, 9 Macbeth M.R....Bass B.L. (Science 2005)
    8. Editing of glutamate receptor B subunit ion channel RNAs by four alternatively spliced DRADA2 double-stranded RNA adenosine deaminases. (PubMed id 9111310)1, 2, 9 Lai F.... Nishikura K. (Mol. Cell. Biol. 1997)
    9. Map location, genomic organization and expression patterns of the human RED1 RNA editase. (PubMed id 9330641)1, 2, 9 Villard L.... Gardiner K. (Somat. Cell Mol. Genet. 1997)
    10. ADAR2 editing enzyme is a novel human immunodeficiency virus-1 proviral factor. (PubMed id 21289159)1, 2 Doria M.... Gallo A. (J. Gen. Virol. 2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 104 HGNC: 226 AceView: ADARB1 Ensembl:ENSG00000197381 euGenes: HUgn104
    ECgene: ADARB1 H-InvDB: ADARB1

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for ADARB1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for ADARB1 gene:
    Search GeneIP for patents involving ADARB1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for ADARB1   OriGene RNAi products in human, mouse, rat for ADARB1  
     OriGene qPCR primer pairs and template standards for ADARB1   OriGene Protein Over-expression Lysate for ADARB1  
     OriGene MassSpec something-or-other for ADARB1   OriGene clones in human, mouse for ADARB1  
     OriGene qSTAR qPCR primer pairs in human, mouse for ADARB1   OriGene Purified Protein for ADARB1  
     OriGene ORF clones in mouse, rat for ADARB1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ADARB1   OriGene Custom Protein Services for ADARB1  

     
     
     Block miRNA regulation of human, mouse, rat ADARB1 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing ADARB1
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ADARB1 Predesigned siRNA for gene silencing in human, mouse, rat ADARB1
     Search QuantiFast Probe-based Assays in human, mouse, rat ADARB1 QuantiTect SYBR Green Assays in human, mouse, rat ADARB1
     Custom PCR Arrays for ADARB1 Search Chromatin IP Primers for ADARB1
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ADARB1  GeneGlobe Interaction Network for ADARB1
     Regulatory tfbs in ADARB1 promoter
     GenScript Custom Purified and Recombinant Proteins Services for ADARB1 GenScript cDNA clones with any tag delivered in your preferred vector for ADARB1
     GenScript Custom Assay Services for ADARB1 GenScript Custom overexpressing Cell Line Services for ADARB1
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for ADARB1 (RED1)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     ADARB1 antibodies
     ADARB1 proteins
     ADARB1 lysates
     Antibodies for ADARB1
     See all of Abcam's Antibodies, Kits and Proteins for ADARB1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for ADARB1
     Antibodies for ADARB1
     ELISAs for ADARB1
     CLIAs for ADARB1



     Browse ESI BIO Cell Lines and PureStem Progenitors for ADARB1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ADARB1
     SwitchGear 3'UTR luciferase reporter plasmids for ADARB1
     SwitchGear Promoter luciferase reporter plasmids for ADARB1
     Search ThermoFisher Antibodies for ADARB1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ADARB1
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ADARB1
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ADARB1
     LSBio Antibodies in human, mouse, rat for ADARB1
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ADARB1 gene at Home site.
    Version: 3.12.166 28 Aug 2014
    hostname: 356980-web2.xennexinc.com index build: 126 solr: 1.4