Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ADAMTSL4 Gene

Aliases for ADAMTSL4 Gene

  • ADAMTS Like 4 2 3 5
  • Thrombospondin Repeat-Containing Protein 1 3 4
  • ADAMTSL-4 3 4
  • TSRC1 3 4
  • Thrombospondin Repeat Containing 1 2
  • ADAMTS-Like Protein 4 3
  • ECTOL2 3

External Ids for ADAMTSL4 Gene

Previous HGNC Symbols for ADAMTSL4 Gene

  • TSRC1

Previous GeneCards Identifiers for ADAMTSL4 Gene

  • GC01P147336
  • GC01P148788
  • GC01P150522
  • GC01P121900

Summaries for ADAMTSL4 Gene

Entrez Gene Summary for ADAMTSL4 Gene

  • This gene is a member of ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs)-like gene family and encodes a protein with seven thrombospondin type 1 repeats. The thrombospondin type 1 repeat domain is found in many proteins with diverse biological functions including cellular adhesion, angiogenesis, and patterning of the developing nervous system. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Sep 2014]

GeneCards Summary for ADAMTSL4 Gene

ADAMTSL4 (ADAMTS Like 4) is a Protein Coding gene. Diseases associated with ADAMTSL4 include Ectopia Lentis Et Pupillae and Ectopia Lentis, Isolated, Autosomal Recessive. Among its related pathways are O-glycosylation of TSR domain-containing proteins and Diseases of glycosylation. GO annotations related to this gene include peptidase activity and protease binding. An important paralog of this gene is THSD4.

UniProtKB/Swiss-Prot for ADAMTSL4 Gene

  • Positive regulation of apoptosis. May facilitate FBN1 microfibril biogenesis.

Gene Wiki entry for ADAMTSL4 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ADAMTSL4 Gene

Genomics for ADAMTSL4 Gene

Regulatory Elements for ADAMTSL4 Gene

Enhancers for ADAMTSL4 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01G150534 1.5 Ensembl ENCODE dbSUPER 35.3 -12.6 -12620 4.9 HDGF ATF1 PKNOX1 ARNT SIN3A FEZF1 GLIS2 ZNF766 GATA2 FOS ADAMTSL4 SEMA6C HORMAD1 TARS2 CTSS RPRD2 C1orf56 MRPS21 GC01P150544 LOC105371436
GH01G150531 1.5 Ensembl ENCODE dbSUPER 28.7 -16.9 -16866 1.9 PKNOX1 FOXA2 ARID4B ZNF2 ZNF48 YY1 ZNF143 SP5 ZHX2 REST ADAMTSL4 ECM1 CTSS LOC105371436 GC01P150544
GH01G150514 1.2 ENCODE 33 -33.6 -33555 2.7 CREB3L1 AGO1 ZFP64 DMAP1 FEZF1 YY1 SLC30A9 ZNF143 ZNF263 SP3 ADAMTSL4 SETDB1 GABPB2 MRPS21 PRPF3 LOC100289061 ADAMTSL4-AS1 GOLPH3L HIST2H2BD HIST2H2BC
GH01G150320 1.6 FANTOM5 ENCODE 21.7 -227.6 -227614 2.4 MLX CREB3L1 DMAP1 YBX1 YY1 SLC30A9 ZNF143 ZNF263 SP3 NFYC PRPF3 ADAMTSL4 GABPB2 MRPS21 MCL1 LYSMD1 CTSS SEMA6C TARS2 HORMAD1
GH01G150543 1.3 Ensembl ENCODE 23.5 -5.0 -5049 2.1 HDGF FOXA2 PKNOX1 CREB3L1 AGO1 ARID4B SIN3A DMAP1 FEZF1 ZNF2 ADAMTSL4 MCL1 TARS2 GC01P150544 LOC105371436
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around ADAMTSL4 on UCSC Golden Path with GeneCards custom track

Promoters for ADAMTSL4 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000013518 -269 1401 CREB3L1 SIN3A DMAP1 ZNF48 ZBTB7B GLIS2 ELK1 KDM4B REST SMARCB1

Genomic Location for ADAMTSL4 Gene

Chromosome:
1
Start:
150,549,369 bp from pter
End:
150,560,937 bp from pter
Size:
11,569 bases
Orientation:
Plus strand

Genomic View for ADAMTSL4 Gene

Genes around ADAMTSL4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ADAMTSL4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ADAMTSL4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ADAMTSL4 Gene

Proteins for ADAMTSL4 Gene

  • Protein details for ADAMTSL4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q6UY14-ATL4_HUMAN
    Recommended name:
    ADAMTS-like protein 4
    Protein Accession:
    Q6UY14
    Secondary Accessions:
    • B2RTT0
    • F8WAD0
    • Q5T5F7
    • Q6IPM6
    • Q8N643
    • Q9HBS6

    Protein attributes for ADAMTSL4 Gene

    Size:
    1074 amino acids
    Molecular mass:
    116545 Da
    Quaternary structure:
    • Interacts with CTSB. Interacts with FBN1.
    SequenceCaution:
    • Sequence=AAG17217.1; Type=Frameshift; Positions=719; Evidence={ECO:0000305};

    Alternative splice isoforms for ADAMTSL4 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ADAMTSL4 Gene

Post-translational modifications for ADAMTSL4 Gene

  • N-glycosylated. Can be O-fucosylated by POFUT2 on a serine or a threonine residue found within the consensus sequence C1-X(2)-(S/T)-C2-G of the TSP type-1 repeat domains where C1 and C2 are the first and second cysteine residue of the repeat, respectively. Fucosylated repeats can then be further glycosylated by the addition of a beta-1,3-glucose residue by the glucosyltransferase, B3GALTL. Fucosylation mediates the efficient secretion of ADAMTS family members. Also can be C-glycosylated with one or two mannose molecules on tryptophan residues within the consensus sequence W-X-X-W of the TPRs. N- and C-glycosylations can also facilitate secretion (By similarity).
  • Glycosylation at Ser107, posLast=181181, posLast=260260, Ser304, Thr319, posLast=490490, and posLast=773773
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for ADAMTSL4 Gene

Domains & Families for ADAMTSL4 Gene

Gene Families for ADAMTSL4 Gene

Protein Domains for ADAMTSL4 Gene

Suggested Antigen Peptide Sequences for ADAMTSL4 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with ADAMTSL4: view

No data available for UniProtKB/Swiss-Prot for ADAMTSL4 Gene

Function for ADAMTSL4 Gene

Molecular function for ADAMTSL4 Gene

UniProtKB/Swiss-Prot Function:
Positive regulation of apoptosis. May facilitate FBN1 microfibril biogenesis.

Gene Ontology (GO) - Molecular Function for ADAMTSL4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002020 protease binding IPI 16364318
GO:0004222 metalloendopeptidase activity IEA --
GO:0005515 protein binding IPI 16189514
GO:0008233 peptidase activity IEA --
genes like me logo Genes that share ontologies with ADAMTSL4: view
genes like me logo Genes that share phenotypes with ADAMTSL4: view

Human Phenotype Ontology for ADAMTSL4 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

miRNA for ADAMTSL4 Gene

miRTarBase miRNAs that target ADAMTSL4

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for ADAMTSL4 Gene

Localization for ADAMTSL4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ADAMTSL4 Gene

Secreted, extracellular space, extracellular matrix. Note=Colocalizes with FMN1 microfibrils in the eye ECM.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ADAMTSL4 gene
Compartment Confidence
extracellular 4
endoplasmic reticulum 4
plasma membrane 3
cytosol 2
lysosome 1

Gene Ontology (GO) - Cellular Components for ADAMTSL4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
GO:0005576 extracellular region IEA --
GO:0005578 proteinaceous extracellular matrix IEA --
GO:0005614 interstitial matrix IEA --
GO:0005615 extracellular space IEA --
genes like me logo Genes that share ontologies with ADAMTSL4: view

Pathways & Interactions for ADAMTSL4 Gene

genes like me logo Genes that share pathways with ADAMTSL4: view

Gene Ontology (GO) - Biological Process for ADAMTSL4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002064 epithelial cell development IEA --
GO:0006508 proteolysis IEA --
GO:0006915 apoptotic process IEA --
GO:0030198 extracellular matrix organization IEA --
GO:0036066 protein O-linked fucosylation TAS --
genes like me logo Genes that share ontologies with ADAMTSL4: view

No data available for SIGNOR curated interactions for ADAMTSL4 Gene

Drugs & Compounds for ADAMTSL4 Gene

No Compound Related Data Available

Transcripts for ADAMTSL4 Gene

Unigene Clusters for ADAMTSL4 Gene

ADAMTS-like 4:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for ADAMTSL4 Gene

No ASD Table

Relevant External Links for ADAMTSL4 Gene

GeneLoc Exon Structure for
ADAMTSL4
ECgene alternative splicing isoforms for
ADAMTSL4

Expression for ADAMTSL4 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ADAMTSL4 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for ADAMTSL4 Gene

This gene is overexpressed in Serum (49.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for ADAMTSL4 Gene



NURSA nuclear receptor signaling pathways regulating expression of ADAMTSL4 Gene:

ADAMTSL4

SOURCE GeneReport for Unigene cluster for ADAMTSL4 Gene:

Hs.516243

mRNA Expression by UniProt/SwissProt for ADAMTSL4 Gene:

Q6UY14-ATL4_HUMAN
Tissue specificity: Expressed in colon, heart, leukocyte, liver, lung, skeletal muscle, spleen, testis and placenta. Weaker expression in bone marrow, brain tissue, kidney and pancreas. Expression studies in fetal tissues reveal strong expression in heart, kidney, liver, lung and skeletal muscle, but weaker expression in fetal brain and skin.

Evidence on tissue expression from TISSUES for ADAMTSL4 Gene

  • Liver(4.2)
  • Bone marrow(4.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ADAMTSL4 Gene

Germ Layers:
  • ectoderm
Systems:
  • nervous
Organs:
Head and neck:
  • brain
  • cranial nerve
  • eye
  • eyelid
  • head
General:
  • peripheral nervous system
genes like me logo Genes that share expression patterns with ADAMTSL4: view

Primer Products

No data available for mRNA differential expression in normal tissues and Protein tissue co-expression partners for ADAMTSL4 Gene

Orthologs for ADAMTSL4 Gene

This gene was present in the common ancestor of animals.

Orthologs for ADAMTSL4 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ADAMTSL4 34 35
  • 99.32 (n)
cow
(Bos Taurus)
Mammalia ADAMTSL4 34 35
  • 86.62 (n)
dog
(Canis familiaris)
Mammalia ADAMTSL4 34 35
  • 85.13 (n)
rat
(Rattus norvegicus)
Mammalia Adamtsl4 34
  • 82.44 (n)
mouse
(Mus musculus)
Mammalia Adamtsl4 34 16 35
  • 82.3 (n)
oppossum
(Monodelphis domestica)
Mammalia ADAMTSL4 35
  • 68 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 31 (a)
ManyToMany
chicken
(Gallus gallus)
Aves -- 35
  • 25 (a)
ManyToMany
lizard
(Anolis carolinensis)
Reptilia ADAMTSL4 35
  • 50 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia adamtsl4 34
  • 56.28 (n)
zebrafish
(Danio rerio)
Actinopterygii LOC100333903 34
  • 56.71 (n)
ADAMTSL4 35
  • 37 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG6232 35
  • 25 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 33 (a)
OneToMany
Species where no ortholog for ADAMTSL4 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ADAMTSL4 Gene

ENSEMBL:
Gene Tree for ADAMTSL4 (if available)
TreeFam:
Gene Tree for ADAMTSL4 (if available)

Paralogs for ADAMTSL4 Gene

(3) SIMAP similar genes for ADAMTSL4 Gene using alignment to 4 proteins:

genes like me logo Genes that share paralogs with ADAMTSL4: view

Variants for ADAMTSL4 Gene

Sequence variations from dbSNP and Humsavar for ADAMTSL4 Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs118203985 Pathogenic 150,556,974(+) TTTTA(G/T)CAGTA nc-transcript-variant, upstream-variant-2KB, reference, stop-gained
rs199473693 Pathogenic 150,553,758(+) CACCC(-/AGGCCTCTGGCACAGAGCCC)CAGAG intron-variant, nc-transcript-variant, upstream-variant-2KB, reference, frameshift-variant
rs368482584 Pathogenic 150,557,296(+) GGAAA(C/T)GAGTG nc-transcript-variant, upstream-variant-2KB, reference, stop-gained
rs587776927 Pathogenic 150,552,897(+) ATATA(A/G)GTGTT intron-variant, nc-transcript-variant, upstream-variant-2KB, splice-acceptor-variant
rs794726688 Pathogenic 150,553,817(+) TCTTC(-/CGTGCATCCCC)TCAGC intron-variant, nc-transcript-variant, upstream-variant-2KB, reference, frameshift-variant

Structural Variations from Database of Genomic Variants (DGV) for ADAMTSL4 Gene

Variant ID Type Subtype PubMed ID
nsv1006838 CNV gain 25217958
nsv1144403 CNV deletion 24896259
nsv527379 CNV loss 19592680

Variation tolerance for ADAMTSL4 Gene

Residual Variation Intolerance Score: 97.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.35; 76.83% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for ADAMTSL4 Gene

Human Gene Mutation Database (HGMD)
ADAMTSL4
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ADAMTSL4

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ADAMTSL4 Gene

Disorders for ADAMTSL4 Gene

MalaCards: The human disease database

(9) MalaCards diseases for ADAMTSL4 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
ectopia lentis et pupillae
  • ectopia lentis with ectopia of pupil
ectopia lentis, isolated, autosomal recessive
  • ectopia lentis, isolated autosomal recessive
isolated ectopia lentis
  • ectopia lentis syndrome
adamtsl4-related eye disorders
anisometropia
- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

ATL4_HUMAN
  • Ectopia lentis 2, isolated, autosomal recessive (ECTOL2) [MIM:225100]: An ocular abnormality characterized by partial or complete displacement of the lens from its space resulting from defective zonule formation. {ECO:0000269 PubMed:19200529}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Ectopia lentis et pupillae (ECTOLP) [MIM:225200]: An ocular abnormality characterized by displacement of the lenses and the pupils, associated with other ocular anomalies, but without systemic manifestations. The condition is usually bilateral, with the lenses and pupils displaced in opposite directions. Additional signs include enlarged corneal diameter, increased corneal astigmatism, increased anterior chamber depth, thinning and flattening of the iris with loss of crypts, angle malformation caused by enlarged iris processes, persistent pupillary membrane, loss of zonular fibers, tilted disk, and increased axial length. Secondary manifestations include refractive errors, glaucoma, early cataract development, and retinal detachment. Membrane formation on the posterior aspect of the iris has been observed both in histologic sections and on ultrasound biomicroscopy. {ECO:0000269 PubMed:20702823}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for ADAMTSL4

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
ADAMTSL4
genes like me logo Genes that share disorders with ADAMTSL4: view

No data available for Genatlas for ADAMTSL4 Gene

Publications for ADAMTSL4 Gene

  1. TSRC1, a widely expressed gene containing seven thrombospondin type I repeats. (PMID: 12706885) Buchner D.A. … Meisler M.H. (Gene 2003) 2 3 4 22 64
  2. ADAMTSL4, a secreted glycoprotein widely distributed in the eye, binds Fibrillin-1 microfibrils and accelerates microfibril biogenesis. (PMID: 21989719) Gabriel L.A. … Apte S.S. (Invest. Ophthalmol. Vis. Sci. 2012) 3 4 64
  3. A novel ADAMTSL4 mutation in autosomal recessive ectopia lentis et pupillae. (PMID: 20702823) Christensen A.E. … dahl E. (Invest. Ophthalmol. Vis. Sci. 2010) 3 4 64
  4. A homozygous mutation in ADAMTSL4 causes autosomal-recessive isolated ectopia lentis. (PMID: 19200529) Ahram D. … El-Shanti H. (Am. J. Hum. Genet. 2009) 3 4 64
  5. The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory S.G. … Bentley D.R. (Nature 2006) 3 4 64

Products for ADAMTSL4 Gene

Sources for ADAMTSL4 Gene

Content
Loading form....