Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

ACHE Gene

protein-coding   GIFtS: 70
GCID: GC07M100487

acetylcholinesterase

(Previous names: acetylcholinesterase (YT blood group), acetylcholinesterase...)
(Previous symbol: YT)
 Explore 146 diseases affiliated with
ACHE via our new
 Human Malady Compendium 
Biological research products
for ACHE
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Acetylcholinesterase1     N-ACHE2
YT1 2 5     Apoptosis-Related Acetylcholinesterase2
EC 3.1.1.73 8     Yt Blood Group2
Acetylcholinesterase (Yt Blood Group)1     AChE3
ACEE2     EC 3.1.18
ARACHE2     

External Ids:    HGNC: 1081   Entrez Gene: 432   Ensembl: ENSG000000870857   OMIM: 1007405   UniProtKB: P223033   

Export aliases for ACHE gene to outside databases

Previous GC identifers: GC07M099022 GC07M100085 GC07M100099 GC07M100132 GC07M100325 GC07M095117


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for ACHE:
Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic
synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it
constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar
catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is
encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA
splicing, and post-translational associations of catalytic and structural subunits. The major form of
acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked
oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed
primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a
GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added
post-translationally. (provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: ACES_HUMAN, P22303
Function: Terminates signal transduction at the neuromuscular junction by rapid hydrolysis of the acetylcholine
released into the synaptic cleft. Role in neuronal apoptosis

summary for ACHE:
Cholinesterases inactivate the neurotransmitter acetylcholine by catalyzing its hydrolysis to choline and
acetic acid. Acetylcholinesterase (AChE) is found in erythroid cells and at neuronal synapses, whilst
butyrylcholinesterase is mostly expressed in the liver. The high enzymatic rate of AChE means that it
effectively terminates signal transmission at cholinergic synpases. AChE is the target of organophosphate
nerve agents such as sarin and VX. Clinically, AChE inhibitors have found a number of uses, with
physostigmine used to treat glaucoma. AChE inhibitors are also used in the management of mild to moderate
Alzheimer's disease.

Gene Wiki entry for ACHE (Acetylcholinesterase)


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000007.13  NC_018918.1  NT_007933.15  NT_079595.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the ACHE gene promoter:
         TBP   Sp1   Egr-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): ACHE promoter sequence
   Search SABiosciences Chromatin IP Primers for ACHE

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ACHE


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 7q22   Ensembl cytogenetic band:  7q22.1   HGNC cytogenetic band: 7q22

ACHE Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ACHE gene location

GeneLoc information about chromosome 7         GeneLoc Exon Structure

GeneLoc location for GC07M100487:  view genomic region     (about GC identifiers)

Start:
100,487,615 bp from pter      End:
100,494,594 bp from pter
Size:
6,980 bases      Orientation:
minus strand

1 alternative location:
Chr7-,CRA_TCAG 99,847,220-99,853,146     

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: ACES_HUMAN, P22303 (See protein sequence)
Recommended Name: Acetylcholinesterase precursor  
Size: 614 amino acids; 67796 Da
Subunit: Interacts with PRIMA1. The interaction with PRIMA1 is required to anchor it to the basal lamina of cells and
organize into tetramers (By similarity). Isoform H generates GPI-anchored dimers; disulfide linked. Isoform T
generates multiple structures, ranging from monomers and dimers to collagen-tailed and hydrophobic-tailed forms, in
which catalytic tetramers are associated with anchoring proteins that attach them to the basal lamina or to cell
membranes. In the collagen-tailed forms, isoform T subunits are associated with a specific collagen, COLQ, which
triggers the formation of isoform T tetramers, from monomers and dimers. Isoform R may be monomeric
Subcellular location: Cell junction, synapse. Secreted (By similarity). Cell membrane; Peripheral membrane protein (By
similarity)
Subcellular location: Isoform T: Nucleus. Note=Only observed in apoptotic nuclei
Subcellular location: Isoform H: Cell membrane; Lipid-anchor, GPI-anchor; Extracellular side (By similarity)
6/13 PDB 3D structures from and Proteopedia for ACHE (see all 13):
1B41 (3D)        1F8U (3D)        1PUV (3D)        1PUW (3D)        1VZJ (3D)        2CLJ (3D)    
Secondary accessions: A4D2E2 B7ZKZ0 D6W5X7 Q16169 Q29S23 Q2M324 Q504V3 Q53F46 Q86TM9 Q86YX9 Q9BXP7
Alternative splicing: 4 isoforms:  P22303-1   P22303-2   P22303-4   P22303-3   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for ACHE: NX_P22303

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_P22303

  • 4/27 DME Specific Peptides for ACHE (P22303) (see all 27)
     AFGFLAL  HGYEIEF  LALQWVQ  PNGPWAT 

    ACHE Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins (2 alternative transcripts): 
    NP_000656.1  NP_056646.1  

    ENSEMBL proteins: 
     ENSP00000403474   ENSP00000241069   ENSP00000414858   ENSP00000394976   ENSP00000397143  
     ENSP00000390004   ENSP00000410380   ENSP00000399725   ENSP00000415901   ENSP00000404865  
     ENSP00000396360   ENSP00000400933   ENSP00000303211  
    Reactome Protein details: P22303
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    R&D Systems Recombinant & Natural Proteins for ACHE (Acetylcholinesterase/ACHE)
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: ACHE
    OriGene Protein Over-expression Lysate (see all 3): ACHE
    OriGene Custom Protein Services for ACHE 
    GenScript Custom Purified and Recombinant Proteins Services for ACHE
    Novus Biologicals ACHE Proteins
    Novus Biologicals ACHE Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Uscn

    Gene Ontology (GO): 5/19 cellular component terms (GO ID links to tree view) (see all 19):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005576extracellular region TAS11283752
    GO:0005605basal lamina NAS16289501
    GO:0005615extracellular space IBA--
    GO:0005634nucleus IEA--
    GO:0005788endoplasmic reticulum lumen IBA--


    ACHE for ontologies           About GeneDecksing



    ACHE Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of ACHE
    Browse R&D Systems for Antibodies
    OriGene Antibodies (see all 3): ACHE
    OriGene Custom Antibody Services for ACHE 
    GenScript Superior Antibodies for ACHE
    Novus Biologicals ACHE Antibodies
    Abcam antibodies for ACHE 
    Browse Antibodies at Uscn
    ThermoFisher Antibody for ACHE

    Assay Products for ACHE: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ACHE
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs and CLIAs at Uscn


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    ACHE for domains           About GeneDecksing

    5 InterPro domains/families:
     IPR019826 Carboxylesterase_B_AS
     IPR000997 Cholinesterase
     IPR014788 AChE_tetra
     IPR019819 Carboxylesterase_B_CS
     IPR002018 CarbesteraseB

    Graphical View of Domain Structure for InterPro Entry P22303

    ProtoNet protein and cluster: P22303

    1 Blocks protein family: IPB000997 Cholinesterase signature

    UniProtKB/Swiss-Prot: ACES_HUMAN, P22303
    Similarity: Belongs to the type-B carboxylesterase/lipase family


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: ACES_HUMAN, P22303
    Function: Terminates signal transduction at the neuromuscular junction by rapid hydrolysis of the acetylcholine
    released into the synaptic cleft. Role in neuronal apoptosis
    Catalytic activity: Acetylcholine + H(2)O = choline + acetate

         Genatlas biochemistry entry for ACHE:
    acetylcholinesterase

    Enzyme Numbers (IUBMB): EC 3.1.1.71 2 EC 3.1.12

    miRNA
    Products:
        
    OriGene 3'-UTR Clone (see all 2): ACHE
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ACHE
    8/13 QIAGEN miScript miRNA Assays for microRNAs that regulate ACHE (see all 13):
    hsa-miR-4324 hsa-miR-3184 hsa-miR-125a-5p hsa-miR-3065-5p hsa-miR-423-5p hsa-miR-587 hsa-miR-124 hsa-miR-125b
    SwitchGear 3'UTR luciferase reporter plasmidACHE 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ACHE (see all 7)
    OriGene shRNA RFP: ACHE
    OriGene siRNA: ACHE
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ACHE

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ACHE

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ACHE (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ACHE (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 2): ACHE (NM_015831)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ACHE
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ACHE 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ACHE
    Search LifeMap BioReagents cell lines for ACHE

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ACHE

    Gene Ontology (GO): 5/12 molecular function terms (GO ID links to tree view) (see all 12):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001540beta-amyloid binding TAS11283752
    GO:0003990acetylcholinesterase activity IMP1517212
    GO:0004091carboxylesterase activity IBA--
    GO:0004104cholinesterase activity IDA1517212
    GO:0005515protein binding IPI18194455


    ACHE for ontologies           About GeneDecksing


    Animal Models:
         Mouse knock-outs for ACHE: Achetm4Pata Achetm4.1Pata Achetm1.1Hssh Achetm3Pata Achetm1Loc
         14 MGI mutant phenotypes (inferred from 8 alleles(MGI details for Ache):
     adipose tissue  behavior/neurological  craniofacial  growth/size  hearing/vestibular/ear 
     hematopoietic system  homeostasis/metabolism  mortality/aging  muscle  nervous system 
     no phenotypic analysis  reproductive system  respiratory system  vision/eye 

    ACHE for phenotypes           About GeneDecksing


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways - 5/16 super-pathways (see all 16About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Glycerophospholipid biosynthesis
    Glycerophospholipid biosynthesis1.00
    Glycerophospholipid metabolism0.54
    Phospholipid metabolism0.64
    2Transmission across Chemical Synapses
    Transmission across Chemical Synapses1.00
    Neuronal System0.67
    3Metabolism
    Metabolism1.00
    Metabolism of lipids and lipoproteins0.34
    4Integrated Pancreatic Cancer Pathway
    Integrated Pancreatic Cancer Pathway1.00
    Integrated Pancreatic Cancer Pathway0.99
    5Synthesis, Secretion, and Inactivation of Glucose-dependent Insulinotropic Polypeptide (GIP)
    Synthesis, Secretion, and Deacylation of Ghrelin0.46
    Deacylation of Acyl Ghrelin0.00

    Pathway sources
    See GeneCards unified pathways
    Show all pathways


    5/6 BioSystems Pathways for ACHE (see all 6
        Acetylcholine Synthesis
    Biogenic Amine Synthesis
    Monoamine Transport
    Integrated Pancreatic Cancer Pathway
    Integrated Pancreatic Cancer Pathway

    5/12        Reactome Pathways for ACHE (see all 12)
        Transmission across Chemical Synapses
    Metabolism
    Phospholipid metabolism
    Neuronal System
    Synthesis of PC

    2 PharmGKB Pathways for ACHE
        Sympathetic Nerve Pathway (Neuroeffector Junction)
    Sympathetic Nerve Pathway (Pre- and Post- Ganglionic Junction)

    2         Kegg Pathways  (Kegg details for ACHE):
        Glycerophospholipid metabolism
    Cholinergic synapse


    ACHE for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for ACHE

    STRING Interaction Network Preview (showing 5 interactants - click image to see 21)

    5/23 Interacting proteins for ACHE (P223031, 2, 3 ENSP000003032114) via UniProtKB, MINT, STRING, and/or I2D (see all 23)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    COLQQ9Y2151, 3, ENSP000003732984EBI-1637793,EBI-1637847 I2D: score=3 STRING: ENSP00000373298
    GNB2L1P632441, 3, ENSP000003660134EBI-1637793,EBI-2559282 I2D: score=1 STRING: ENSP00000366013
    ENO1P067331, 3, ENSP000002345904EBI-1637793,EBI-353877 I2D: score=1 STRING: ENSP00000234590
    APPP050673, ENSP000002849814I2D: score=3 STRING: ENSP00000284981
    LAMB1P079423, ENSP000002223994I2D: score=2 STRING: ENSP00000222399
    About this table

    Gene Ontology (GO): 5/28 biological process terms (GO ID links to tree view) (see all 28):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001507acetylcholine catabolic process in synaptic cleft NAS1517212
    GO:0001919regulation of receptor recycling IEA--
    GO:0002076osteoblast development IEP15454088
    GO:0006260DNA replication TAS11283752
    GO:0006581acetylcholine catabolic process IDA1517212


    ACHE for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    ACHE for compounds           About GeneDecksing

    EMD Millipore small molecules for ACHE:
    Small Molecule - inhibitor
    Enzo Life Sciences drugs & compounds for ACHE

    Compounds for ACHE available from Tocris Bioscience    About this table
    CompoundAction CAS #
    Tacrine hydrochlorideCholinesterase inhibitor[1684-40-8]
    Physostigmine hemisulfateCholinesterase inhibitor[64-47-1]
    Galanthamine hydrobromideCholinesterase inhibitor[1953-04-4]
    Ambenonium dichlorideCholinesterase inhibitor[52022-31-8]
    AcephateAnticholinesterase insecticide[30560-19-1]

    5 HMDB Compounds for ACHE    About this table
    CompoundSynonyms CAS #PubMed Ids
    Acetic acidAcetate (see all 12)64-19-7--
    AcetylcholineACh (see all 7)51-84-3--
    Choline(2-Hydroxyethyl)trimethyl ammonium (see all 19)62-49-7--
    DonepezilAricept (see all 3)120014-06-4--
    WaterDihydrogen oxide (see all 2)7732-18-5--

    10/49 DrugBank Compounds for ACHE (see all 49)    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    Galantamine(-)-Galanthamine (see all 3)357-70-0targetinhibitor10971049 12137632 10606746 11129124 10762042 11752352 12481195 20480924 11078030 10592235 12177686 10971048 1026294
    Rivastigmine-- 123441-03-2targetinhibitor18671661 12636181 19470293 11139819 19370562 10673128 10713582 11752352 18044073 10587286 14587496 11078030
    TacrineTetrahydroaminacrine (see all 5)321-64-2targetinhibitor10210906 12871155 10513568 10024872 17218977 15544504 15544507 11752352 10375753 16880719 16860785 10208549
    Donepezil-- 120014-06-4targetinhibitor20193764 10513568 10641971 10024872 11893059 11752352 10466911 10368299 20522977
    Ambenonium-- 7648-98-8targetinhibitor11330337 2857786 11752352 5833399 1588924 13679187 15982786
    EdrophoniumEDR (see all 5)116-38-1targetinhibitor10089512 10103097 11752352 10363282 19472276 10421446 10433700
    Neostigmine-- 59-99-4targetinhibitor19257799 10826417 11752352 12522088 12726885 11819669 11313435
    Gallamine TriethiodideBenzcurine Iodide (see all 9)65-29-2targetinhibitor1207670 17944454 10421444 417864 11920914 3190453
    IsoflurophateDFP (see all 4)55-91-4targetinhibitor10898598 1692236 11752352 12837382 10378121 11350858
    PhysostigmineErserine (see all 4)57-47-6targetinhibitor11141093 10873710 10741458 10403635 11752352 10368402

    10/136 Novoseek chemical compound relationships for ACHE gene (see all 136)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    donepezil 93.8 464 18587286 (6), 11068139 (5), 19935404 (5), 12454562 (4) (see all 99)
    galantamine 93.2 293 1954303 (6), 9839013 (3), 19969445 (3), 12635450 (3) (see all 99)
    acetylthiocholine 92.9 110 10869180 (3), 9427520 (2), 11275256 (2), 18602908 (2) (see all 68)
    rivastigmine 92.6 264 9737824 (8), 10587286 (5), 12454562 (4), 15275830 (4) (see all 99)
    obidoxime 92.2 140 14985944 (4), 18588863 (3), 15498514 (3), 19429253 (3) (see all 73)
    tacrine 91 286 1538717 (6), 2023867 (4), 1954303 (4), 8186246 (4) (see all 99)
    pralidoxime 90.8 116 11180275 (4), 9587020 (3), 18254274 (2), 18676153 (2) (see all 71)
    oxime 88.9 448 20028185 (7), 15498514 (6), 17900152 (6), 16904809 (5) (see all 99)
    thiocholine 88.5 33 15987132 (2), 19238297 (2), 15826103 (1), 17499494 (1) (see all 22)
    acetylcholine 88.3 981 2096961 (4), 9489729 (4), 10576601 (3), 1819171 (3) (see all 99)

    Search CenterWatch for drugs/clinical trials and news about ACHE / ACES 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for ACHE gene (2 alternative transcripts): 
    NM_000665.3  NM_015831.2  

    Unigene Cluster for ACHE:

    Acetylcholinesterase
    Hs.154495  [show with all ESTs]
    Unigene Representative Sequence: NM_015831
    14 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000419336(uc003uxj.1) ENST00000241069 ENST00000428317(uc003uxi.3)
    ENST00000412389(uc003uxd.3) ENST00000426415 ENST00000454485 ENST00000440755
    ENST00000430554 ENST00000442452 ENST00000411582 ENST00000441605 ENST00000445236
    ENST00000497647 ENST00000302913(uc003uxe.3 uc003uxf.3 uc003uxg.3 uc003uxh.3)


    miRNA
    Products:
         
    OriGene 3'-UTR Clone (see all 2): ACHE
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat ACHE
    8/13 QIAGEN miScript miRNA Assays for microRNAs that regulate ACHE (see all 13):
    hsa-miR-4324 hsa-miR-3184 hsa-miR-125a-5p hsa-miR-3065-5p hsa-miR-423-5p hsa-miR-587 hsa-miR-124 hsa-miR-125b
    SwitchGear 3'UTR luciferase reporter plasmidACHE 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ACHE (see all 7)
    OriGene shRNA RFP: ACHE
    OriGene siRNA: ACHE
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ACHE
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ACHE (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ACHE (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 2): ACHE (NM_015831)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ACHE
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ACHE 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ACHE
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ACHE
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ACHE
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ACHE

    Additional cDNA sequence: 

    AF334270.1 AK223443.1 AK291321.1 AY389977.1 BC026315.1 BC036813.1 BC094752.1 BC105060.1 
    BC105062.1 BC143469.1 M55040.1 

    11 DOTS entries:

    DT.416657  DT.121041597  DT.100751908  DT.100751910  DT.101984170  DT.121041603  DT.75103919  DT.97776847 
    DT.121041601  DT.101984168  DT.101984171 

    24/134 AceView cDNA sequences (see all 134):

    CD014075 CD014073 CD014072 BE551703 CK904419 BE466391 BI753192 BC036813 
    BM719818 AI360141 CD014074 CA394873 H38691 CD014076 BC001541 CD014071 
    BM023149 BQ225068 AI690171 BI488594 AY389977 BX390630 AW418501 H19954 

    GeneLoc Exon Structure

    5/11 Alternative Splicing Database (ASD) splice patterns (SP) for ACHE (see all 11)    About this scheme

    ExUns: 1 ^ 2 ^ 3a · 3b · 3c ^ 4a · 4b ^ 5a · 5b ^ 6a · 6b ^ 7a · 7b ^ 8 ^ 9a · 9b
    SP1:        -     -                                                                 -               
    SP2:              -                             -     -     -                       -               
    SP3:              -                                                                 -               
    SP4:                                            -     -                             -               
    SP5:                                                                                -               


    ECgene alternative splicing isoforms for ACHE

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    ACHE expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: --

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image

    ACHE expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    4 LifeMap In Vivo Development Anatomical Compartments/Cells 
    Tissue Anatomical Compartment CellCategory (developmental path)
    EyeInner Nuclear LayerMature Horizontal CellsHorizontal, Retina
    Spinal CordSpinal Ventral ColumnsVentral Spinal Cord Progenitor CellsMotor Neurons
    Head MesenchymeHead MesenchymeHead Mesenchyme
    Spinal CordSpinal Ventral ColumnsSpinal Cord
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization
    Stem Cell Differentiation: 1 LifeMap Cell 
    NameCategory
    Definitive endoderm-like cells (A scalable, suspensi...)

    See ACHE Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for ACHE

    SOURCE GeneReport for Unigene cluster: Hs.154495

    UniProtKB/Swiss-Prot: ACES_HUMAN, P22303
    Tissue specificity: Isoform H is highly expressed in erythrocytes

        SABiosciences Expression via Pathway-Focused PCR Arrays including ACHE: 
              Neurogenesis in human mouse rat
              Alzheimer's Disease in human mouse rat

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ACHE
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat ACHE
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ACHE
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ACHE
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ACHE

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for ACHE gene from 6/19 species (see all 19)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves ACHE1 acetylcholinesterase 64.18(n)
    63.41(a)
      396388  NM_205418.1  NP_990749.1 
    lizard
    (Anolis carolinensis)
    Reptilia --
    --
    24(a)
    possible ortholog
    GL344755.1(13434-20364)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.89632 Xenopus laevis transcribed sequence with weak similarity to protein pirA39256 (H.sapiens) A39256 acetylcholinesterase (EC 3.1.1.7) precursor, brain splice form - human less 71.5(n)    CB563700.1 
    zebrafish
    (Danio rerio)
    Actinopterygii ache2 acetylcholinesterase 73.74(n)   114549  NM_131846.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta alpha-Est83 carboxylesterase 36(a)
    (best of 26)
      3 84D9   --
    worm
    (Caenorhabditis elegans)
    Secernentea R173.33
    ace-11
    esterase3
    Protein ACE-11
    42(a)
    (best of 15)3
    47.89(n)1
    43.3(a)1
      X(7065997-7071293)3
    1817061  NM_078259.51  NP_510660.11 


    ENSEMBL Gene Tree for ACHE (if available)
    TreeFam Gene Tree for ACHE (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for ACHE gene
    NLGN12  CES22  CES4A2  NLGN4X2  NLGN4Y2  CES32  NLGN32  NLGN22  
    CES12  CEL2  CES5A2  BCHE2  
    15 SIMAP similar genes for ACHE using alignment to 11 protein entries:     ACES_HUMAN (see all proteins):
    BCHE    CES1P1    CES4A    CES3    TG    CES5A
    CES2    DKFZp686F02202    NLGN3    CES hBr2    CES8    CEL
    CES1    NLGN4X    NLGN2

    ACHE for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    UniProtKB/Swiss-Prot: ACES_HUMAN, P22303
    Polymorphism: ACHE is responsible for the Yt blood group system [MIM:112100]. The molecular basis of the
    Yt(a)=Yt1/Yt(b)=Yt2 blood group antigens is a single variation in position 353; His-353 corresponds to Yt(a) and the
    rare variant with Asn-353 to Yt(b)


    10/206 NCBI SNPs in ACHE are shown (see all 206    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 7 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs17998051,2
    C,F,H,non-pathogenic99850402(-) ACTTCC/AACGGC 4 /N /H mis1 ese318Minor allele frequency- A:0.03MN NS EA NA EU 7462
    rs27339181,2
    C,H--99846740(+) CGGGAG/ACGGAT 2 -- ds50014Minor allele frequency- A:0.00NS EA 420
    rs27339191,2
    H--99846745(+) ACGGAG/TGTCCC 2 -- ds50014Minor allele frequency- T:0.00NS EA 420
    rs178858231,2
    C,F,--99846906(-) GGTGGC/TTGCCT 2 -- ds50012Minor allele frequency- T:0.04NS 92
    rs178807001,2
    C,F,--99846922(-) TCGGTC/AGGTGC 2 -- ds50013Minor allele frequency- A:0.09NS NA 92
    rs22516311,2
    A,--99846967(-) aggggA/Cggggc 2 -- ds50010--------
    rs600310541,2
    C--99846967(+) GCCCC-/GCCCCTCCCCT
    CCCCTCCCCTCCCC
    TCCCC
    2 -- ds50011Minor allele frequency- GCCCCTCCCCTCCCCTCCCCTCCCC:0.00NA 2
    rs624825121,2
    --99846984(+) CCCTCC/TCCTCC 2 -- ds50010--------
    rs23967551,2
    C,F,H,--99847125(+) GCCTGT/CTTCTT 2 -- ds500118Minor allele frequency- C:0.10NS EA NA CSA WA 2194
    rs1119023191,2
    F,--99847130(+) TTTCTC/TGCCCT 2 -- ds50012Minor allele frequency- T:0.40CSA 5

    HapMap Linkage Disequilibrium report for ACHE (100487615 - 100494594 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 2 variations for ACHE
         2 CNVs: 3692 82117
    Human Gene Mutation Database (HGMD): ACHE

    Locus Specific Mutation Databases (LSDB): ACHE
    Blood Group Antigen Gene Mutation Database (BGMUT) blood group system

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ACHE
    DNA2.0 Custom Variant and Variant Library Synthesis for ACHE

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    ACHE for disorders           About GeneDecksing

    OMIM gene information: 100740   
    OMIM disorders: 112100  
    20/146 diseases for ACHE (see all 146):    About MalaCards
    endplate acetylcholinesterase deficiency    intestinal pseudo-obstruction    aplasia cutis congenita    schwartz-jampel syndrome
    glaucoma    epidermolysis bullosa    colonic pseudo-obstruction    neural tube defect
    rem sleep behavior disorder    alzheimer's disease    wernicke-korsakoff syndrome    epidermolysis bullosa with pyloric atresia
    junctional epidermolysis bullosa    paroxysmal nocturnal hemoglobinuria    supranuclear palsy    abdominal wall defect
    myasthenia gravis    amyotrophic lateral sclerosis (als)    lewy body dementia    colonic aganglionosis

    10/93 Novoseek disease relationships for ACHE gene (see all 93)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    alzheimers disease 89 829 1469405 (5), 17553629 (4), 9269216 (4), 12669110 (4) (see all 99)
    acetylcholinesterase expression 83.2 30 17000130 (5), 17320203 (4), 12707285 (2), 1692114 (1) (see all 20)
    endplate acetylcholinesterase deficiency 81.6 14 12609505 (3), 16009904 (1), 18647752 (1), 18374322 (1) (see all 9)
    myasthenic syndromes congenital 79.3 22 12609505 (2), 9758617 (2), 15248101 (1), 16009904 (1) (see all 13)
    hirschsprung disease 78.5 96 11528605 (4), 14680278 (3), 8747488 (3), 11719866 (3) (see all 46)
    poisoning 76.8 185 15065394 (4), 10477195 (3), 16601804 (2), 18281016 (2) (see all 93)
    dementia 76.1 180 1469405 (4), 9351648 (4), 8951800 (3), 14676050 (3) (see all 99)
    senile plaques 69.6 93 1703383 (3), 9282941 (3), 9062656 (3), 1717194 (2) (see all 46)
    dementia vascular 64.5 18 17215726 (2), 15224429 (1), 18174021 (1), 20110698 (1) (see all 15)
    intoxication 63.5 75 16601804 (2), 18045198 (2), 17194020 (2), 20028185 (2) (see all 48)

    Genetic Association Database (GAD): ACHE
    Human Genome Epidemiology (HuGE) Navigator: ACHE (32 documents)

    Export disorders for ACHE gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for ACHE gene, integrated from 9 sources (see all 2369):
    (articles sorted by number of sources associating them with ACHE)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Mutagenesis of human acetylcholinesterase. Identification of residues involved in catalytic activity and in polypeptide folding. (PubMed id 1517212)1, 2, 9 Shafferman A.... Barak D. (1992)
    2. Expression of three alternative acetylcholinesterase messenger RNAs in human tumor cell lines of different tissue origins. (PubMed id 8299725)1, 2, 9 Karpel R.... Soreq H. (1994)
    3. Inherited and acquired interactions between ACHE and PON1 polymorphisms modulate plasma acetylcholinesterase and paraoxonase activities. (PubMed id 15715671)1, 4, 9 Bryk B....Soreq H. (2005)
    4. Candidate gene association studies of genes involved in neuronal cholinergic transmission in Alzheimer's disease suggests choline acetyltransferase as a candidate deserving further study. (PubMed id 15690550)1, 4, 9 Cook L.J....Rubinsztein D.C. (2005)
    5. Structures of recombinant native and E202Q mutant human acetylcholinesterase complexed with the snake-venom toxin fasciculin- II. (PubMed id 11053835)1, 2, 9 Kryger G....Sussman J.L. (2000)
    6. Analysis of genetic polymorphisms in acetylcholinesterase as reflected in different populations. (PubMed id 15974920)1, 4, 9 Hasin Y....Sussman J.L. (2005)
    7. The synaptic acetylcholinesterase tetramer assembles around a polyproline II helix. (PubMed id 15526038)1, 2 Dvir H.... Silman I. (2004)
    8. Acetylcholinesterase/paraoxonase genotype and expression predict anxiety scores in Health, Risk Factors, Exercise Training, and Genetics study. (PubMed id 15060281)1, 4 Sklan E.H....Soreq H. (2004)
    9. A paradigm for single nucleotide polymorphism analysis: the case of the acetylcholinesterase gene. (PubMed id 15459952)1, 4 Hasin Y....Sussman J.L. (2004)
    10. Association study between Alzheimer's disease and genes involved in Abeta biosynthesis, aggregation and degradation: suggestive results with BACE1. (PubMed id 12928915)1, 4 Clarimon J....Comas D. (2003)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 43 HGNC: 108 AceView: ACHE Ensembl:ENSG00000087085 euGenes: HUgn43
    ECgene: ACHE Kegg: 43 H-InvDB: ACHE

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for ACHE Pharmacogenomics, SNPs, Pathways
    dbRBC/BGMUThttp://www.ncbi.nlm.nih.gov/gv/mhc/xslcgi.cgi?cmd=bgmut/systems_info&system=yt
    Wikipedia http://en.wikipedia.org/wiki/Acetylcholinesterase
    SeattleSNPshttp://pga.gs.washington.edu/data/ache/

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for ACHE gene:
    Search GeneIP for patents involving ACHE

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of ACHE
     EMD Millipore small molecules (inhibitor) for ACHE
     Browse Kits and Assays available from EMD Millipore
     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse for Gene Knock-down Tools from EMD Millipore
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Recombinant/Natural Proteins for ACHE (Acetylcholinesterase/ACHE)  
     OriGene Antibodies for ACHE   OriGene shRNA RFP for ACHE  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for ACHE   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for ACHE  
     OriGene Protein Over-expression Lysate for ACHE   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for ACHE   OriGene 3'-UTR Clone for ACHE  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for ACHE   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for ACHE  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for ACHE   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ACHE   OriGene Custom Protein Services for ACHE  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat ACHE
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing ACHE
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat ACHE
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat ACHE
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat ACHE
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat ACHE
     GenScript Custom Purified and Recombinant Proteins Services for ACHE GenScript cDNA clones with any tag delivered in your preferred vector for ACHE
     GenScript Custom Assay Services for ACHE GenScript Superior Antibodies for ACHE
     GenScript Custom overexpressing Cell Line Services for ACHE CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in ACHE promoter
     Search Chromatin IP Primers for ACHE
     RT2 qPCR Primer Assay in human, mouse, rat ACHE
     GNC Network for ACHE
     SABiosciences PCR Arrays including human, mouse, rat ACHE
     Tocris compounds for ACHE
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Drugs for ACHE
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     ACHE antibodies
     ACHE proteins
     ACHE lysates
     Antibodies for ACHE
     See all of Abcam's Antibodies, Kits and Proteins for ACHE
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Browse ELISAs, CLIAs, Proteins, and Antibodies at Uscn
     Search LifeMap BioReagents cell lines for ACHE
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ACHE
     SwitchGear 3'UTR luciferase reporter plasmids for ACHE
     SwitchGear Promoter luciferase reporter plasmids for ACHE
     ThermoFisher Antibody for ACHE
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ACHE
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ACHE gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4