Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ACAD11 Gene

Aliases for ACAD11 Gene

  • Acyl-CoA Dehydrogenase Family Member 11 2 3 5
  • Acyl-Coenzyme A Dehydrogenase Family, Member 11 2 3
  • Acyl-CoA Dehydrogenase Family, Member 11 2 3
  • ACAD-11 3 4
  • EC 1.3.99.- 4

External Ids for ACAD11 Gene

Previous GeneCards Identifiers for ACAD11 Gene

  • GC03M133761
  • GC03M132276
  • GC03M129656

Summaries for ACAD11 Gene

Entrez Gene Summary for ACAD11 Gene

  • This gene encodes an acyl-CoA dehydrogenase enzyme with a preference for carbon chain lengths between 20 and 26. Naturally occurring read-through transcription occurs between the upstream gene NPHP3 (nephronophthisis 3 (adolescent)) and this gene. [provided by RefSeq, Aug 2015]

GeneCards Summary for ACAD11 Gene

ACAD11 (Acyl-CoA Dehydrogenase Family Member 11) is a Protein Coding gene. Diseases associated with ACAD11 include Nephronophthisis 3. Among its related pathways are Regulation of lipid metabolism by Peroxisome proliferator-activated receptor alpha (PPARalpha) and Metabolism. GO annotations related to this gene include transferase activity, transferring phosphorus-containing groups and oxidoreductase activity, acting on the CH-CH group of donors. An important paralog of this gene is ACAD8.

UniProtKB/Swiss-Prot for ACAD11 Gene

  • Acyl-CoA dehydrogenase, that exhibits maximal activity towards saturated C22-CoA.

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ACAD11 Gene

Genomics for ACAD11 Gene

Regulatory Elements for ACAD11 Gene

Enhancers for ACAD11 Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around ACAD11 on UCSC Golden Path with GeneCards custom track

Promoters for ACAD11 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around ACAD11 on UCSC Golden Path with GeneCards custom track

Genomic Location for ACAD11 Gene

Chromosome:
3
Start:
132,558,138 bp from pter
End:
132,660,723 bp from pter
Size:
102,586 bases
Orientation:
Minus strand

Genomic View for ACAD11 Gene

Genes around ACAD11 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ACAD11 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ACAD11 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ACAD11 Gene

Proteins for ACAD11 Gene

  • Protein details for ACAD11 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q709F0-ACD11_HUMAN
    Recommended name:
    Acyl-CoA dehydrogenase family member 11
    Protein Accession:
    Q709F0
    Secondary Accessions:
    • Q08AF0
    • Q658N9
    • Q658Y2
    • Q6ZND2
    • Q8WUT6
    • Q9H9R3

    Protein attributes for ACAD11 Gene

    Size:
    780 amino acids
    Molecular mass:
    87283 Da
    Cofactor:
    Name=FAD; Xref=ChEBI:CHEBI:57692;
    Quaternary structure:
    • Homodimer.
    SequenceCaution:
    • Sequence=BAB14158.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for ACAD11 Gene

    Alternative splice isoforms for ACAD11 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ACAD11 Gene

Proteomics data for ACAD11 Gene at MOPED

Post-translational modifications for ACAD11 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for ACAD11 Gene

No data available for DME Specific Peptides for ACAD11 Gene

Domains & Families for ACAD11 Gene

Gene Families for ACAD11 Gene

Suggested Antigen Peptide Sequences for ACAD11 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q709F0

UniProtKB/Swiss-Prot:

ACD11_HUMAN :
  • Belongs to the acyl-CoA dehydrogenase family.
Family:
  • Belongs to the acyl-CoA dehydrogenase family.
genes like me logo Genes that share domains with ACAD11: view

Function for ACAD11 Gene

Molecular function for ACAD11 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
Acyl-CoA + acceptor = 2,3-dehydroacyl-CoA + reduced acceptor.
UniProtKB/Swiss-Prot Function:
Acyl-CoA dehydrogenase, that exhibits maximal activity towards saturated C22-CoA.

Enzyme Numbers (IUBMB) for ACAD11 Gene

Gene Ontology (GO) - Molecular Function for ACAD11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000062 fatty-acyl-CoA binding IBA --
GO:0003995 acyl-CoA dehydrogenase activity IEA,TAS --
GO:0004466 long-chain-acyl-CoA dehydrogenase activity IDA 21237683
GO:0009055 electron carrier activity IBA --
GO:0050660 flavin adenine dinucleotide binding IEA,IBA --
genes like me logo Genes that share ontologies with ACAD11: view
genes like me logo Genes that share phenotypes with ACAD11: view

Animal Model Products

  • Taconic Biosciences Mouse Models for ACAD11

No data available for Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for ACAD11 Gene

Localization for ACAD11 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ACAD11 Gene

Peroxisome. Mitochondrion. Note=Has been detected associated with mitochondrial membrane, but no matrix, in kidney and cerebellum, as well as in a neuroblastoma cell line, but not in skin fibroblasts, where it is observed in cytoplasmic vesicles (PubMed:21237683). No mitochondrial targeting signals could be predicted for any known isoform, including a putative isoform starting at Met-316. {ECO:0000269 PubMed:21237683}.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for ACAD11 Gene COMPARTMENTS Subcellular localization image for ACAD11 gene
Compartment Confidence
mitochondrion 5
nucleus 5
peroxisome 4
cytosol 2

No data available for Gene Ontology (GO) - Cellular Components for ACAD11 Gene

Pathways & Interactions for ACAD11 Gene

genes like me logo Genes that share pathways with ACAD11: view

Interacting Proteins for ACAD11 Gene

Gene Ontology (GO) - Biological Process for ACAD11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0055088 lipid homeostasis IBA --
GO:0055114 oxidation-reduction process IEA --
genes like me logo Genes that share ontologies with ACAD11: view

No data available for SIGNOR curated interactions for ACAD11 Gene

Drugs & Compounds for ACAD11 Gene

(1) Drugs for ACAD11 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Propionyl-CoA Experimental Pharma 0

(31) Additional Compounds for ACAD11 Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
(2E)-Decenoyl-CoA
  • (E)-S-2-decenoate
  • (E)-S-2-decenoate CoA
  • (E)-S-2-decenoate Coenzyme A
  • (E)-S-2-decenoic acid
  • 2-trans-Decenoyl-CoA
10018-95-8
(2E)-Dodecenoyl-CoA
  • (2E)-Dodec-2-enoyl-CoA
  • (2E)-Dodec-2-enoyl-Coenzyme A
  • 2-trans-Dodecenoyl-CoA
  • 2-trans-Dodecenoyl-Coenzyme A
1066-12-2
(2E)-Hexadecenoyl-CoA
  • (2E)-Hexadecenoyl-CoA
  • (2E)-Hexadecenoyl-Coenzyme A
  • trans-2-Hexadecenoyl-CoA
  • trans-2-Hexadecenoyl-Coenzyme A
4460-95-1
(2E)-Octenoyl-CoA
  • (E)-S-2-octenoate
  • (E)-S-2-octenoate CoA
  • (E)-S-2-octenoate Coenzyme A
  • (E)-S-2-octenoic acid
  • 2,3-trans-Octenoyl coenzyme A
10018-94-7
(2E)-Tetradecenoyl-CoA
  • (2E)-Tetradecenoyl-CoA
  • (2E)-Tetradecenoyl-Coenzyme A
  • Trans-tetra-dec-2-enoyl-CoA
  • Trans-tetra-dec-2-enoyl-CoA.
  • Trans-tetra-dec-2-enoyl-Coenzyme A
38795-33-4
genes like me logo Genes that share compounds with ACAD11: view

Transcripts for ACAD11 Gene

Unigene Clusters for ACAD11 Gene

Acyl-CoA dehydrogenase family, member 11:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for ACAD11 Gene

No ASD Table

Relevant External Links for ACAD11 Gene

GeneLoc Exon Structure for
ACAD11
ECgene alternative splicing isoforms for
ACAD11

Expression for ACAD11 Gene

mRNA expression in normal human tissues for ACAD11 Gene

Protein differential expression in normal tissues from HIPED for ACAD11 Gene

This gene is overexpressed in Gallbladder (41.0) and Liver (16.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MOPED, and MaxQB for ACAD11 Gene



SOURCE GeneReport for Unigene cluster for ACAD11 Gene Hs.441378

mRNA Expression by UniProt/SwissProt for ACAD11 Gene

Q709F0-ACD11_HUMAN
Tissue specificity: Widely expressed with highest levels in brain followed by liver, heart and kidney.
genes like me logo Genes that share expression patterns with ACAD11: view

Protein tissue co-expression partners for ACAD11 Gene

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for ACAD11 Gene

Orthologs for ACAD11 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for ACAD11 Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia ACAD11 35
  • 88.33 (n)
  • 85 (a)
ACAD11 36
  • 82 (a)
OneToOne
dog
(Canis familiaris)
Mammalia ACAD11 35
  • 88.25 (n)
  • 86.03 (a)
ACAD11 36
  • 86 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Acad11 35
  • 81.17 (n)
  • 81.09 (a)
Acad11 16
Acad11 36
  • 80 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia ACAD11 35
  • 99.62 (n)
  • 99.36 (a)
ACAD11 36
  • 99 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Acad11 35
  • 81.02 (n)
  • 81.19 (a)
oppossum
(Monodelphis domestica)
Mammalia ACAD11 36
  • 77 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia -- 36
  • 60 (a)
OneToMany
-- 36
  • 76 (a)
OneToMany
-- 36
  • 82 (a)
OneToMany
chicken
(Gallus gallus)
Aves ACAD11 35
  • 71.73 (n)
  • 70.39 (a)
ACAD11 36
  • 69 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia ACAD11 36
  • 67 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia acad11 35
  • 65.68 (n)
  • 67.14 (a)
zebrafish
(Danio rerio)
Actinopterygii acad11 35
  • 63.55 (n)
  • 64.82 (a)
zgc55835 35
acad11 36
  • 64 (a)
OneToOne
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AFL213W 35
  • 41.95 (n)
  • 32 (a)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0E15181g 35
  • 45.99 (n)
  • 31.41 (a)
wheat
(Triticum aestivum)
Liliopsida Ta.25699 35
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.11416 35
bread mold
(Neurospora crassa)
Ascomycetes NCU01181 35
  • 53.5 (n)
  • 51.75 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 36
  • 47 (a)
OneToOne
Species with no ortholog for ACAD11:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • worm (Caenorhabditis elegans)

Evolution for ACAD11 Gene

ENSEMBL:
Gene Tree for ACAD11 (if available)
TreeFam:
Gene Tree for ACAD11 (if available)

Paralogs for ACAD11 Gene

Paralogs for ACAD11 Gene

(3) SIMAP similar genes for ACAD11 Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with ACAD11: view

Variants for ACAD11 Gene

Sequence variations from dbSNP and Humsavar for ACAD11 Gene

SNP ID Clin Chr 03 pos Sequence Context AA Info Type
VAR_028825 -
VAR_028826 -
rs746249517 -- 132,626,813(+) ACTGA(-/AAGTTCTTTGCCAAAAGAAAAAAGGAAAAAAAGGT)TACAA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for ACAD11 Gene

Variant ID Type Subtype PubMed ID
nsv829728 CNV Gain 17160897
esv2675190 CNV Deletion 23128226
esv2669271 CNV Deletion 23128226

Variation tolerance for ACAD11 Gene

Residual Variation Intolerance Score: 63.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.50; 71.82% of all genes are more intolerant (likely to be disease-causing)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Relevant External Links for ACAD11 Gene

Disorders for ACAD11 Gene

MalaCards: The human disease database

(1) MalaCards diseases for ACAD11 Gene - From: GeneCards

Disorder Aliases PubMed IDs
nephronophthisis 3
  • adolescent nephronophthisis
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for ACAD11

Genetic Association Database (GAD)
ACAD11
Human Genome Epidemiology (HuGE) Navigator
ACAD11
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
ACAD11
genes like me logo Genes that share disorders with ACAD11: view

No data available for UniProtKB/Swiss-Prot and Genatlas for ACAD11 Gene

Publications for ACAD11 Gene

  1. Identification and characterization of new long chain acyl-CoA dehydrogenases. (PMID: 21237683) He M. … Vockley J. (Mol. Genet. Metab. 2011) 3 4 67
  2. Analysis of p53 transactivation domain mutants reveals Acad11 as a metabolic target important for p53 pro-survival function. (PMID: 25704813) Jiang D. … Attardi L.D. (Cell Rep 2015) 3
  3. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3
  4. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. (PMID: 26496610) Hein M.Y. … Mann M. (Cell 2015) 3
  5. A quantitative chaperone interaction network reveals the architecture of cellular protein homeostasis pathways. (PMID: 25036637) Taipale M. … Lindquist S. (Cell 2014) 3

Products for ACAD11 Gene

Sources for ACAD11 Gene

Content