Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ABCC11 Gene

Aliases for ABCC11 Gene

  • ATP Binding Cassette Subfamily C Member 11 2 3 5
  • ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 11 2 3
  • Multidrug Resistance-Associated Protein 8 3 4
  • MRP8 3 4
  • ATP-Binding Cassette Transporter Sub-Family C Member 11 3
  • ATP-Binding Cassette Sub-Family C Member 11 3
  • ATP-Binding Cassette Transporter MRP8 3
  • ATP-Binding Cassette Protein C11 3
  • Multi-Resistance Protein 8 3
  • EWWD 3
  • WW 3

External Ids for ABCC11 Gene

Previous GeneCards Identifiers for ABCC11 Gene

  • GC16M038615
  • GC16M047938
  • GC16M047978
  • GC16M046758
  • GC16M034090

Summaries for ABCC11 Gene

Entrez Gene Summary for ABCC11 Gene

  • The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]

GeneCards Summary for ABCC11 Gene

ABCC11 (ATP Binding Cassette Subfamily C Member 11) is a Protein Coding gene. Diseases associated with ABCC11 include Apocrine Gland Secretion, Variation In and Breast Cancer. Among its related pathways are CDK-mediated phosphorylation and removal of Cdc6 and Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds. Gene Ontology (GO) annotations related to this gene include ATPase activity and organic anion transmembrane transporter activity. An important paralog of this gene is ABCC12.

UniProtKB/Swiss-Prot for ABCC11 Gene

  • Participates in physiological processes involving bile acids, conjugated steroids and cyclic nucleotides (PubMed:12764137, PubMed:15537867). Enhances the cellular extrusion of cAMP and cGMP (PubMed:12764137, PubMed:15537867). Stimulates the ATP-dependent uptake of a range of physiological and synthetic lipophilic anions, including the glutathione S-conjugates leukotriene C4 and dinitrophenyl S-glutathione, steroid sulfates such as dehydroepiandrosterone 3-sulfate (DHEAS) and estrone 3-sulfate, glucuronides such as estradiol 17-beta-D-glucuronide (E(2)17betaG), the monoanionic bile acids glycocholate and taurocholate, and methotrexate (PubMed:15537867, PubMed:25896536). Probably functions to secrete earwax (PubMed:16444273, PubMed:19383836). Required for the secretion of components contributing to axillary odor formation (PubMed:19710689).

Gene Wiki entry for ABCC11 Gene

Additional gene information for ABCC11 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ABCC11 Gene

Genomics for ABCC11 Gene

GeneHancer (GH) Regulatory Elements for ABCC11 Gene

Promoters and enhancers for ABCC11 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH16I048243 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 11.2 +2.8 2758 2.8 PKNOX1 MLX ARNT ZFP64 ARID4B SIN3A DMAP1 IRF4 YY1 SLC30A9 LONP2 ABCC11
GH16I048203 Enhancer 0.9 ENCODE 20.9 +42.8 42800 2 FOXA2 MLX ZFP64 ARID4B DMAP1 ZNF48 YY1 ATF7 RXRA SP5 LONP2 ABCC11 ENSG00000261538
GH16I048555 Enhancer 1.3 FANTOM5 Ensembl ENCODE 11 -310.3 -310333 4.2 MEIS2 PKNOX1 FOXA2 SAP130 MAX EBF1 FEZF1 BATF IRF4 FOSL1 ENSG00000261267 N4BP1 ABCC11 LONP2 ENSG00000260052 SIAH1 PIR50161
GH16I048408 Enhancer 1.2 Ensembl ENCODE 10.4 -162.6 -162626 3.2 ATF1 FOXA2 MLX ZFP64 ARID4B DMAP1 ZNF48 ETS1 YY1 ATF7 LONP2 ABCC11 GC16P048414 SIAH1 ENSG00000280067
GH16I048630 Enhancer 1 Ensembl ENCODE 11.3 -382.9 -382857 0.8 ELF3 RB1 ZFP64 ARID4B BATF ZNF2 DNMT3B ZNF48 ZSCAN9 RAD21 LONP2 ABCC11 ENSG00000260052 ENSG00000261267 ENSG00000260086 LOC105371240
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ABCC11 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ABCC11 gene promoter:

Genomic Locations for ABCC11 Gene

Genomic Locations for ABCC11 Gene
chr16:48,166,910-48,247,568
(GRCh38/hg38)
Size:
80,659 bases
Orientation:
Minus strand
chr16:48,200,821-48,281,479
(GRCh37/hg19)

Genomic View for ABCC11 Gene

Genes around ABCC11 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ABCC11 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ABCC11 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ABCC11 Gene

Proteins for ABCC11 Gene

  • Protein details for ABCC11 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96J66-ABCCB_HUMAN
    Recommended name:
    ATP-binding cassette sub-family C member 11
    Protein Accession:
    Q96J66
    Secondary Accessions:
    • Q8TDJ0
    • Q96JA6
    • Q9BX80

    Protein attributes for ABCC11 Gene

    Size:
    1382 amino acids
    Molecular mass:
    154301 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for ABCC11 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for ABCC11 Gene

Post-translational modifications for ABCC11 Gene

  • Glycosylation at Asn838, posLast=844844, and posLast=992992

No data available for DME Specific Peptides for ABCC11 Gene

Domains & Families for ABCC11 Gene

Gene Families for ABCC11 Gene

HGNC:
IUPHAR :
Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted membrane proteins

Suggested Antigen Peptide Sequences for ABCC11 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q96J66

UniProtKB/Swiss-Prot:

ABCCB_HUMAN :
  • Belongs to the ABC transporter superfamily. ABCC family. Conjugate transporter (TC 3.A.1.208) subfamily.
Family:
  • Belongs to the ABC transporter superfamily. ABCC family. Conjugate transporter (TC 3.A.1.208) subfamily.
genes like me logo Genes that share domains with ABCC11: view

Function for ABCC11 Gene

Molecular function for ABCC11 Gene

UniProtKB/Swiss-Prot Function:
Participates in physiological processes involving bile acids, conjugated steroids and cyclic nucleotides (PubMed:12764137, PubMed:15537867). Enhances the cellular extrusion of cAMP and cGMP (PubMed:12764137, PubMed:15537867). Stimulates the ATP-dependent uptake of a range of physiological and synthetic lipophilic anions, including the glutathione S-conjugates leukotriene C4 and dinitrophenyl S-glutathione, steroid sulfates such as dehydroepiandrosterone 3-sulfate (DHEAS) and estrone 3-sulfate, glucuronides such as estradiol 17-beta-D-glucuronide (E(2)17betaG), the monoanionic bile acids glycocholate and taurocholate, and methotrexate (PubMed:15537867, PubMed:25896536). Probably functions to secrete earwax (PubMed:16444273, PubMed:19383836). Required for the secretion of components contributing to axillary odor formation (PubMed:19710689).

Gene Ontology (GO) - Molecular Function for ABCC11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005524 ATP binding IEA --
GO:0008514 organic anion transmembrane transporter activity IDA 15537867
GO:0015216 purine nucleotide transmembrane transporter activity IDA 12764137
GO:0016887 ATPase activity IEA --
GO:0042626 ATPase activity, coupled to transmembrane movement of substances IBA --
genes like me logo Genes that share ontologies with ABCC11: view
genes like me logo Genes that share phenotypes with ABCC11: view

miRNA for ABCC11 Gene

miRTarBase miRNAs that target ABCC11

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for ABCC11 Gene

Localization for ABCC11 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ABCC11 Gene

Cell membrane; Multi-pass membrane protein. Vacuole membrane. Cytoplasmic vesicle membrane.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ABCC11 gene
Compartment Confidence
plasma membrane 5
extracellular 5

Gene Ontology (GO) - Cellular Components for ABCC11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005773 vacuole IEA --
GO:0005774 vacuolar membrane IEA --
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane IDA 16359813
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with ABCC11: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for ABCC11 Gene

Pathways & Interactions for ABCC11 Gene

genes like me logo Genes that share pathways with ABCC11: view

Pathways by source for ABCC11 Gene

1 KEGG pathway for ABCC11 Gene

Gene Ontology (GO) - Biological Process for ABCC11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006810 transport IEA --
GO:0015711 organic anion transport IDA 15537867
GO:0015865 purine nucleotide transport IDA 12764137
GO:0055085 transmembrane transport TAS --
GO:0099133 ATP hydrolysis coupled anion transmembrane transport IEA --
genes like me logo Genes that share ontologies with ABCC11: view

No data available for SIGNOR curated interactions for ABCC11 Gene

Drugs & Compounds for ABCC11 Gene

(12) Drugs for ABCC11 Gene - From: DrugBank, PharmGKB, FDA Approved Drugs, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Methotrexate Approved Pharma Transporter, substrate Folate antagonist,inhibits DFHR 1603
Probenecid Approved, Investigational Pharma Inhibition, Inhibitor, Transporter, inhibitor 35
Folic Acid Approved, Vet_approved Nutra Transporter, substrate 4610
conjugated estrogens Approved Pharma Transporter, substrate 0
Indomethacin Approved, Investigational Pharma Partial agonist, Agonist, Transporter, inhibitor Cox inhibitor 119

(2) Additional Compounds for ABCC11 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with ABCC11: view

Transcripts for ABCC11 Gene

Unigene Clusters for ABCC11 Gene

ATP-binding cassette, sub-family C (CFTR/MRP), member 11:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ABCC11 Gene

ExUns: 1 ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22a · 22b ^ 23 ^
SP1: - -
SP2: - -
SP3: -
SP4:
SP5:

ExUns: 24 ^ 25 ^ 26 ^ 27 ^ 28 ^ 29 ^ 30 ^ 31 ^ 32
SP1: -
SP2: - -
SP3: -
SP4:
SP5:

Relevant External Links for ABCC11 Gene

GeneLoc Exon Structure for
ABCC11
ECgene alternative splicing isoforms for
ABCC11

Expression for ABCC11 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ABCC11 Gene

mRNA differential expression in normal tissues according to GTEx for ABCC11 Gene

This gene is overexpressed in Liver (x11.0), Testis (x8.2), and Breast - Mammary Tissue (x7.6).

Protein differential expression in normal tissues from HIPED for ABCC11 Gene

This gene is overexpressed in Heart (29.7), Monocytes (27.6), and Liver (11.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for ABCC11 Gene



Protein tissue co-expression partners for ABCC11 Gene

NURSA nuclear receptor signaling pathways regulating expression of ABCC11 Gene:

ABCC11

SOURCE GeneReport for Unigene cluster for ABCC11 Gene:

Hs.652267

mRNA Expression by UniProt/SwissProt for ABCC11 Gene:

Q96J66-ABCCB_HUMAN
Tissue specificity: Expressed in ceruminous apocrine gland (at protein level) (PubMed:19383836, PubMed:19710689). Expressed in many tissues. Not expressed in kidney, spleen and colon. Highly expressed in breast cancer. Expressed at moderate levels in normal breast and testis and at very low levels in liver, brain and placenta.

Evidence on tissue expression from TISSUES for ABCC11 Gene

  • Liver(4.4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ABCC11 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • integumentary
  • reproductive
  • skeletal muscle
Organs:
Head and neck:
  • ear
  • head
Thorax:
  • breast
genes like me logo Genes that share expression patterns with ABCC11: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery for ABCC11 Gene

Orthologs for ABCC11 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for ABCC11 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia ABCC11 34 33
  • 99.06 (n)
OneToOne
dog
(Canis familiaris)
Mammalia ABCC11 34 33
  • 81.44 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia ABCC11 34
  • 67 (a)
OneToOne
cow
(Bos Taurus)
Mammalia ABCC11 34
  • 67 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia ABCC11 34
  • 56 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii abcc12 34
  • 47 (a)
OneToMany
fruit fly
(Drosophila melanogaster)
Insecta Sur 35 34
  • 41 (a)
barley
(Hordeum vulgare)
Liliopsida Hv.10235 33
wheat
(Triticum aestivum)
Liliopsida Ta.27443 33
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 36 (a)
OneToMany
Species where no ortholog for ABCC11 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • worm (Caenorhabditis elegans)

Evolution for ABCC11 Gene

ENSEMBL:
Gene Tree for ABCC11 (if available)
TreeFam:
Gene Tree for ABCC11 (if available)

Paralogs for ABCC11 Gene

Paralogs for ABCC11 Gene

genes like me logo Genes that share paralogs with ABCC11: view

Variants for ABCC11 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for ABCC11 Gene

ABCCB_HUMAN-Q96J66
Polymorphism in ABCC11 is associated with variation in apocrine gland secretion [MIM:117800]. This determines different ear wax phenotypes, presence or absence of axillary odor, and variation in colostrum secretion. Characteristic of earwax and strength of axillary odor are most likely interconnected. Human earwax is a Mendelian trait consisting of wet and dry types. The wet earwax is brownish and sticky, whereas the dry type lacks cerumen. The wet cerumen phenotype is completely dominant. The dry type is seen frequently (80-95%) among East Asians, but uncommon (0-3%) in populations of European and African origins. Intermediate frequencies (30-50%) of the dry type are seen in populations of Southern Asia, the Pacific Islands, Central Asia and Asia Minor, as well as among the Native North American and Inuit of Asian ancestry. The allele with Arg-180 is responsible for the dry earwax phenotype and lack of axillary odor.

Sequence variations from dbSNP and Humsavar for ABCC11 Gene

SNP ID Clin Chr 16 pos Variation AA Info Type
rs17822931 benign, Apocrine gland secretion, variation in, Axillary odor, Colostrum secretion 48,224,287(-) C/T coding_sequence_variant, genic_upstream_transcript_variant, missense_variant, non_coding_transcript_variant, upstream_transcript_variant
rs387906296 affects, Apocrine gland secretion, variation in 48,167,587(-) TCACGGATTGTGCGCTGGATCAGGGTGTC/TC coding_sequence_variant, genic_downstream_transcript_variant, inframe_deletion, non_coding_transcript_variant
rs1000005538 -- 48,248,215(-) A/G 5_prime_UTR_variant, genic_upstream_transcript_variant, non_coding_transcript_variant, upstream_transcript_variant
rs1000018855 -- 48,187,181(-) A/G genic_downstream_transcript_variant, intron_variant
rs1000097481 -- 48,233,410(-) G/C genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for ABCC11 Gene

Variant ID Type Subtype PubMed ID
nsv472379 CNV novel sequence insertion 20440878
nsv827641 CNV gain 20364138

Variation tolerance for ABCC11 Gene

Residual Variation Intolerance Score: 97.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 18.43; 98.56% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ABCC11 Gene

Human Gene Mutation Database (HGMD)
ABCC11
SNPedia medical, phenotypic, and genealogical associations of SNPs for
ABCC11

Disorders for ABCC11 Gene

MalaCards: The human disease database

(2) MalaCards diseases for ABCC11 Gene - From: OMIM, GTR, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
apocrine gland secretion, variation in
  • ear wax, wet/dry; ewwd
breast cancer
  • breast cancer, familial
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for ABCC11

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ABCC11: view

No data available for UniProtKB/Swiss-Prot and Genatlas for ABCC11 Gene

Publications for ABCC11 Gene

  1. Transport of bile acids, sulfated steroids, estradiol 17-beta-D-glucuronide, and leukotriene C4 by human multidrug resistance protein 8 (ABCC11). (PMID: 15537867) Chen ZS … Kruh GD (Molecular pharmacology 2005) 3 4 22 25 58
  2. MRP8, ATP-binding cassette C11 (ABCC11), is a cyclic nucleotide efflux pump and a resistance factor for fluoropyrimidines 2',3'-dideoxycytidine and 9'-(2'-phosphonylmethoxyethyl)adenine. (PMID: 12764137) Guo Y … Kruh GD (The Journal of biological chemistry 2003) 3 4 22 25 58
  3. Two new genes from the human ATP-binding cassette transporter superfamily, ABCC11 and ABCC12, tandemly duplicated on chromosome 16q12. (PMID: 11483364) Tammur J … Allikmets R (Gene 2001) 2 3 4 22 58
  4. A functional ABCC11 allele is essential in the biochemical formation of human axillary odor. (PMID: 19710689) Martin A … Natsch A (The Journal of investigative dermatology 2010) 3 4 22 58
  5. Earwax, osmidrosis, and breast cancer: why does one SNP (538G>A) in the human ABC transporter ABCC11 gene determine earwax type? (PMID: 19383836) Toyoda Y … Ishikawa T (FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2009) 3 4 22 58

Products for ABCC11 Gene

Sources for ABCC11 Gene

Content
Loading form....