Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ABCC11 Gene

Aliases for ABCC11 Gene

  • ATP Binding Cassette Subfamily C Member 11 2 3 5
  • ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 11 2 3
  • Multidrug Resistance-Associated Protein 8 3 4
  • MRP8 3 4
  • ATP-Binding Cassette Transporter Sub-Family C Member 11 3
  • ATP-Binding Cassette Sub-Family C Member 11 3
  • ATP-Binding Cassette Transporter MRP8 3
  • ATP-Binding Cassette Protein C11 3
  • Multi-Resistance Protein 8 3
  • EWWD 3
  • WW 3

External Ids for ABCC11 Gene

Previous GeneCards Identifiers for ABCC11 Gene

  • GC16M038615
  • GC16M047938
  • GC16M047978
  • GC16M046758
  • GC16M034090

Summaries for ABCC11 Gene

Entrez Gene Summary for ABCC11 Gene

  • The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]

GeneCards Summary for ABCC11 Gene

ABCC11 (ATP Binding Cassette Subfamily C Member 11) is a Protein Coding gene. Among its related pathways are Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds and CDK-mediated phosphorylation and removal of Cdc6. GO annotations related to this gene include ATPase activity and organic anion transmembrane transporter activity. An important paralog of this gene is ABCC12.

UniProtKB/Swiss-Prot for ABCC11 Gene

  • Participates in physiological processes involving bile acids, conjugated steroids and cyclic nucleotides (PubMed:12764137, PubMed:15537867). Enhances the cellular extrusion of cAMP and cGMP (PubMed:12764137, PubMed:15537867). Stimulates the ATP-dependent uptake of a range of physiological and synthetic lipophilic anions, including the glutathione S-conjugates leukotriene C4 and dinitrophenyl S-glutathione, steroid sulfates such as dehydroepiandrosterone 3-sulfate (DHEAS) and estrone 3-sulfate, glucuronides such as estradiol 17-beta-D-glucuronide (E(2)17betaG), the monoanionic bile acids glycocholate and taurocholate, and methotrexate (PubMed:15537867, PubMed:25896536). Probably functions to secrete earwax (PubMed:16444273, PubMed:19383836). Required for the secretion of components contributing to axillary odor formation (PubMed:19710689).

Gene Wiki entry for ABCC11 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ABCC11 Gene

Genomics for ABCC11 Gene

Regulatory Elements for ABCC11 Gene

Enhancers for ABCC11 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16G048203 1 ENCODE 20.9 +42.8 42801 2.0 FOXA2 MLX ZFP64 ARID4B DMAP1 ZNF48 YY1 SP5 ZHX2 MXD4 LONP2 ABCC11 ENSG00000261538
GH16G048555 1.4 FANTOM5 Ensembl ENCODE 11 -310.3 -310333 4.2 PKNOX1 FOXA2 SAP130 MAX FEZF1 ZBTB7B FOSL1 FOS ZSCAN29 IKZF2 N4BP1 ABCC11 LONP2 ENSG00000260052 ENSG00000261267 SIAH1 PIR50161
GH16G048408 1.3 Ensembl ENCODE 10.4 -162.6 -162627 3.2 ATF1 FOXA2 MLX CREB3L1 ZFP64 ARID4B DMAP1 ZNF48 YY1 ZNF121 LONP2 ABCC11 GC16P048414 ENSG00000280067
GH16G048317 1.2 Ensembl ENCODE 11.2 -71.1 -71101 2.4 PKNOX1 ATF1 CREB3L1 MLX ARID4B FEZF1 ZNF48 ZNF2 ETS1 ZNF143 LONP2 ABCC11 GC16P048333
GH16G048562 1.2 Ensembl ENCODE 11 -314.7 -314660 0.5 ELF3 FOXA2 PKNOX1 ATF1 ARID4B BMI1 RAD21 RARA CBX5 RELB N4BP1 LONP2 ABCC11 PIR45350 RPS2P44
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around ABCC11 on UCSC Golden Path with GeneCards custom track

Transcription factor binding sites by QIAGEN in the ABCC11 gene promoter:

Genomic Location for ABCC11 Gene

48,166,910 bp from pter
48,247,568 bp from pter
80,659 bases
Minus strand

Genomic View for ABCC11 Gene

Genes around ABCC11 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ABCC11 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ABCC11 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ABCC11 Gene

Proteins for ABCC11 Gene

  • Protein details for ABCC11 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    ATP-binding cassette sub-family C member 11
    Protein Accession:
    Secondary Accessions:
    • Q8TDJ0
    • Q96JA6
    • Q9BX80

    Protein attributes for ABCC11 Gene

    1382 amino acids
    Molecular mass:
    154301 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for ABCC11 Gene


neXtProt entry for ABCC11 Gene

Post-translational modifications for ABCC11 Gene

  • Glycosylation at posLast=838838, posLast=844844, and posLast=992992
  • Modification sites at PhosphoSitePlus

Antibody Products

  • Cloud-Clone Corp. Antibodies for ABCC11
  • Santa Cruz Biotechnology (SCBT) Antibodies for ABCC11

No data available for DME Specific Peptides for ABCC11 Gene

Domains & Families for ABCC11 Gene

Gene Families for ABCC11 Gene

Suggested Antigen Peptide Sequences for ABCC11 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the ABC transporter superfamily. ABCC family. Conjugate transporter (TC 3.A.1.208) subfamily.
  • Belongs to the ABC transporter superfamily. ABCC family. Conjugate transporter (TC 3.A.1.208) subfamily.
genes like me logo Genes that share domains with ABCC11: view

Function for ABCC11 Gene

Molecular function for ABCC11 Gene

UniProtKB/Swiss-Prot Function:
Participates in physiological processes involving bile acids, conjugated steroids and cyclic nucleotides (PubMed:12764137, PubMed:15537867). Enhances the cellular extrusion of cAMP and cGMP (PubMed:12764137, PubMed:15537867). Stimulates the ATP-dependent uptake of a range of physiological and synthetic lipophilic anions, including the glutathione S-conjugates leukotriene C4 and dinitrophenyl S-glutathione, steroid sulfates such as dehydroepiandrosterone 3-sulfate (DHEAS) and estrone 3-sulfate, glucuronides such as estradiol 17-beta-D-glucuronide (E(2)17betaG), the monoanionic bile acids glycocholate and taurocholate, and methotrexate (PubMed:15537867, PubMed:25896536). Probably functions to secrete earwax (PubMed:16444273, PubMed:19383836). Required for the secretion of components contributing to axillary odor formation (PubMed:19710689).

Gene Ontology (GO) - Molecular Function for ABCC11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005524 ATP binding IEA --
GO:0008514 organic anion transmembrane transporter activity IDA 15537867
GO:0015216 purine nucleotide transmembrane transporter activity IDA 12764137
GO:0016887 ATPase activity IEA --
GO:0042626 ATPase activity, coupled to transmembrane movement of substances IBA --
genes like me logo Genes that share ontologies with ABCC11: view
genes like me logo Genes that share phenotypes with ABCC11: view

Animal Model Products

CRISPR Products

miRNA for ABCC11 Gene

miRTarBase miRNAs that target ABCC11

Inhibitory RNA Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for ABCC11 Gene

Localization for ABCC11 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ABCC11 Gene

Cell membrane; Multi-pass membrane protein. Vacuole membrane. Cytoplasmic vesicle membrane.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ABCC11 gene
Compartment Confidence
plasma membrane 5
extracellular 5

Gene Ontology (GO) - Cellular Components for ABCC11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005773 vacuole IEA --
GO:0005774 vacuolar membrane IEA --
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane IDA 16359813
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with ABCC11: view

Pathways & Interactions for ABCC11 Gene

genes like me logo Genes that share pathways with ABCC11: view

Pathways by source for ABCC11 Gene

1 KEGG pathway for ABCC11 Gene

Gene Ontology (GO) - Biological Process for ABCC11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006810 transport IEA --
GO:0015711 organic anion transport IDA 15537867
GO:0015865 purine nucleotide transport IDA 12764137
GO:0055085 transmembrane transport TAS --
GO:0099133 ATP hydrolysis coupled anion transmembrane transport IEA --
genes like me logo Genes that share ontologies with ABCC11: view

No data available for SIGNOR curated interactions for ABCC11 Gene

Drugs & Compounds for ABCC11 Gene

(12) Drugs for ABCC11 Gene - From: DrugBank, PharmGKB, FDA Approved Drugs, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Methotrexate Approved Pharma Transporter, substrate Folate antagonist,inhibits DFHR 1551
Probenecid Approved Pharma Inhibition, Inhibitor, Transporter, inhibitor 29
Folic Acid Approved, Vet_approved Nutra Transporter, substrate 4392
conjugated estrogens Approved Pharma Transporter, substrate 0
Indomethacin Approved, Investigational Pharma Partial agonist, Agonist, Transporter, inhibitor Cox inhibitor, Cyclooxygenase inhibitor (COX-1 > COX-2) 116

(2) Additional Compounds for ABCC11 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with ABCC11: view

Transcripts for ABCC11 Gene

Unigene Clusters for ABCC11 Gene

ATP-binding cassette, sub-family C (CFTR/MRP), member 11:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for ABCC11 Gene

ExUns: 1 ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22a · 22b ^ 23 ^
SP1: - -
SP2: - -
SP3: -

ExUns: 24 ^ 25 ^ 26 ^ 27 ^ 28 ^ 29 ^ 30 ^ 31 ^ 32
SP1: -
SP2: - -
SP3: -

Relevant External Links for ABCC11 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for ABCC11 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ABCC11 Gene

mRNA differential expression in normal tissues according to GTEx for ABCC11 Gene

This gene is overexpressed in Liver (x11.0), Testis (x8.2), and Breast - Mammary Tissue (x7.6).

Protein differential expression in normal tissues from HIPED for ABCC11 Gene

This gene is overexpressed in Heart (29.7), Monocytes (27.6), and Liver (11.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for ABCC11 Gene

Protein tissue co-expression partners for ABCC11 Gene

NURSA nuclear receptor signaling pathways regulating expression of ABCC11 Gene:


SOURCE GeneReport for Unigene cluster for ABCC11 Gene:


mRNA Expression by UniProt/SwissProt for ABCC11 Gene:

Tissue specificity: Expressed in ceruminous apocrine gland (at protein level) (PubMed:19383836, PubMed:19710689). Expressed in many tissues. Not expressed in kidney, spleen and colon. Highly expressed in breast cancer. Expressed at moderate levels in normal breast and testis and at very low levels in liver, brain and placenta.

Evidence on tissue expression from TISSUES for ABCC11 Gene

  • Liver(4.4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for ABCC11 Gene

Germ Layers:
  • ectoderm
  • mesoderm
  • integumentary
  • reproductive
  • skeletal muscle
Head and neck:
  • ear
  • head
  • breast
genes like me logo Genes that share expression patterns with ABCC11: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery for ABCC11 Gene

Orthologs for ABCC11 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for ABCC11 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia ABCC11 34 35
  • 99.06 (n)
(Canis familiaris)
Mammalia ABCC11 34 35
  • 81.44 (n)
(Bos Taurus)
Mammalia ABCC11 35
  • 67 (a)
(Monodelphis domestica)
Mammalia ABCC11 35
  • 67 (a)
(Ornithorhynchus anatinus)
Mammalia ABCC11 35
  • 56 (a)
(Danio rerio)
Actinopterygii abcc12 35
  • 47 (a)
fruit fly
(Drosophila melanogaster)
Insecta Sur 36 35
  • 41 (a)
(Hordeum vulgare)
Liliopsida Hv.10235 34
(Triticum aestivum)
Liliopsida Ta.27443 34
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 36 (a)
Species where no ortholog for ABCC11 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • worm (Caenorhabditis elegans)

Evolution for ABCC11 Gene

Gene Tree for ABCC11 (if available)
Gene Tree for ABCC11 (if available)

Paralogs for ABCC11 Gene

Paralogs for ABCC11 Gene

genes like me logo Genes that share paralogs with ABCC11: view

Variants for ABCC11 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for ABCC11 Gene

Polymorphism in ABCC11 is associated with variation in apocrine gland secretion [MIM:117800]. This determines different ear wax phenotypes, presence or absence of axillary odor, and variation in colostrum secretion. Characteristic of earwax and strength of axillary odor are most likely interconnected. Human earwax is a Mendelian trait consisting of wet and dry types. The wet earwax is brownish and sticky, whereas the dry type lacks cerumen. The wet cerumen phenotype is completely dominant. The dry type is seen frequently (80-95%) among East Asians, but uncommon (0-3%) in populations of European and African origins. Intermediate frequencies (30-50%) of the dry type are seen in populations of Southern Asia, the Pacific Islands, Central Asia and Asia Minor, as well as among the Native North American and Inuit of Asian ancestry. The allele with Arg-180 is responsible for the dry earwax phenotype and lack of axillary odor.

Sequence variations from dbSNP and Humsavar for ABCC11 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs17822931 Benign 48,224,287(+) TGGCC(C/T)GAGTA nc-transcript-variant, upstream-variant-2KB, reference, missense
rs387906296 other 48,167,587(-) ACAGA(-/CACCCTGATCCAGCGCACAATCCGTGA)AGCCT nc-transcript-variant, cds-indel
rs1000005538 -- 48,248,215(+) CTCCC(A/G)GGTTC intron-variant, nc-transcript-variant, upstream-variant-2KB, utr-variant-5-prime
rs1000018855 -- 48,187,181(+) TCACA(A/G)GCAAA intron-variant
rs1000097481 -- 48,233,410(+) AGCCA(C/G)GGCAC intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for ABCC11 Gene

Variant ID Type Subtype PubMed ID
nsv472379 CNV novel sequence insertion 20440878
nsv827641 CNV gain 20364138

Variation tolerance for ABCC11 Gene

Residual Variation Intolerance Score: 97.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 18.43; 98.56% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for ABCC11 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

Disorders for ABCC11 Gene

Relevant External Links for ABCC11

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for ABCC11 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for ABCC11 Gene

Publications for ABCC11 Gene

  1. Transport of bile acids, sulfated steroids, estradiol 17-beta-D- glucuronide, and leukotriene C4 by human multidrug resistance protein 8 (ABCC11). (PMID: 15537867) Chen Z.S. … Kruh G.D. (Mol. Pharmacol. 2005) 3 4 22 25 64
  2. MRP8, ATP-binding cassette C11 (ABCC11), is a cyclic nucleotide efflux pump and a resistance factor for fluoropyrimidines 2',3'- dideoxycytidine and 9'-(2'-phosphonylmethoxyethyl)adenine. (PMID: 12764137) Guo Y. … Kruh G.D. (J. Biol. Chem. 2003) 3 4 22 25 64
  3. Two new genes from the human ATP-binding cassette transporter superfamily, ABCC11 and ABCC12, tandemly duplicated on chromosome 16q12. (PMID: 11483364) Tammur J. … Allikmets R. (Gene 2001) 2 3 4 22 64
  4. A functional ABCC11 allele is essential in the biochemical formation of human axillary odor. (PMID: 19710689) Martin A. … Natsch A. (J. Invest. Dermatol. 2010) 3 4 22 64
  5. Earwax, osmidrosis, and breast cancer: why does one SNP (538G>A) in the human ABC transporter ABCC11 gene determine earwax type? (PMID: 19383836) Toyoda Y. … Ishikawa T. (FASEB J. 2009) 3 4 22 64

Products for ABCC11 Gene

Sources for ABCC11 Gene

Loading form....