Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

AADACL2 Gene

protein-coding   GIFtS: 45
GCID: GC03P151451

arylacetamide deacetylase-like 2

 Explore 4 diseases affiliated with
AADACL2 via our new
 Human Malady Compendium 
Biological research products
for AADACL2
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Arylacetamide Deacetylase-Like 21 2
MGC720011
EC 3.1.1.-3

External Ids:    HGNC: 244271   Entrez Gene: 3447522   Ensembl: ENSG000001979537   UniProtKB: Q6P0933   

Export aliases for AADACL2 gene to outside databases

Previous GC identifers: GC03P152936 GC03P148843


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

  --

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000003.11  NC_018914.1  NT_005612.16  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the AADACL2 gene promoter:
         Brachyury   FOXD1   Cdc5   MEF-2A   FOXC1   FOXO4   FOXO1a   aMEF-2   FOXO1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidAADACL2 promoter sequence
   Search SABiosciences Chromatin IP Primers for AADACL2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat AADACL2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 3q25.1   Ensembl cytogenetic band:  3q25.1   HGNC cytogenetic band: 3q25.1

AADACL2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
AADACL2 gene location

GeneLoc information about chromosome 3         GeneLoc Exon Structure

GeneLoc location for GC03P151451:  view genomic region     (about GC identifiers)

Start:
151,451,704 bp from pter      End:
151,479,127 bp from pter
Size:
27,424 bases      Orientation:
plus strand

1 alternative location:
Chr3+,PATCHES 151,456,973-151,480,825     

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: ADCL2_HUMAN, Q6P093 (See protein sequence)
Recommended Name: Arylacetamide deacetylase-like 2 precursor  
Size: 401 amino acids; 46099 Da
Subcellular location: Secreted
Sequence caution: Sequence=AAH65724.1; Type=Erroneous initiation; Sequence=CAI46075.1; Type=Miscellaneous discrepancy;
Note=Wrong choice of CDS;
Secondary accessions: Q5HYJ4
Alternative splicing: 2 isoforms:  Q6P093-1   Q6P093-3   (No experimental confirmation available. May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay)

Explore the universe of human proteins at neXtProt for AADACL2: NX_Q6P093

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q6P093

  • AADACL2 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_997248.2  
    ENSEMBL proteins: 
     ENSP00000387390   ENSP00000348911  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: AADACL2
    OriGene Protein Over-expression Lysate: AADACL2
    OriGene Custom Protein Services for AADACL2 
    GenScript Custom Purified and Recombinant Proteins Services for AADACL2
    Novus Biologicals AADACL2 Protein
    Novus Biologicals AADACL2 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for AADACL2

    Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005576extracellular region IEA--
    GO:0016021integral to membrane IEA--


    AADACL2 for ontologies           About GeneDecksing



    AADACL2 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for AADACL2 
    GenScript Custom Superior Antibodies Services for AADACL2
    Novus Biologicals AADACL2 Antibody
    Search for Antibodies for AADACL2 at Abcam  
    Uscn Antibodies for AADACL2
    Search ThermoFisher Antibodies for AADACL2

    Assay Products for AADACL2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for AADACL2
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for AADACL2


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    AADACL2 for domains           About GeneDecksing

    3 InterPro domains/families:
     IPR017157 Arylacetamide_deacetylase
     IPR013094 AB_hydrolase_3
     IPR002168 Lipase_GDXG_AS

    Graphical View of Domain Structure for InterPro Entry Q6P093

    ProtoNet protein and cluster: Q6P093

    2 Blocks protein families:
    IPB002168 Lipolytic enzyme
    IPB013094 Alpha/beta hydrolase fold-3


    UniProtKB/Swiss-Prot: ADCL2_HUMAN, Q6P093
    Similarity: Belongs to the 'GDXG' lipolytic enzyme family


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Enzyme Number (IUBMB): EC 3.1.1.-1

    miRNA
    Products:
        
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat AADACL2
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate AADACL2
    SwitchGear 3'UTR luciferase reporter plasmidAADACL2 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for AADACL2 (see all 4)
    OriGene shRNA RFP: AADACL2
    OriGene siRNA: AADACL2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat AADACL2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for AADACL2

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2 (see all 3)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: AADACL2 (NM_207365)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for AADACL2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AADACL2 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for AADACL2
    Search LifeMap BioReagents cell lines for AADACL2

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AADACL2

    Gene Ontology (GO): 1 molecular function term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004091carboxylesterase activity IEA--


    AADACL2 for ontologies           About GeneDecksing


    1 GenomeRNAi human phenotype for AADACL2:
     Decreased POU5F1-GFP protein e 


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for AADACL2

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for AADACL2

    2 DrugBank Compounds for AADACL2    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    GIBBERELLIN A3-- --target--10592235
    GIBBERELLIN A4-- --target--10592235

    Search CenterWatch for drugs/clinical trials and news about AADACL2 / ADCL2 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for AADACL2 gene: 
    NM_207365.3  

    Unigene Cluster for AADACL2:

    Arylacetamide deacetylase-like 2
    Hs.144710  [show with all ESTs]
    Unigene Representative Sequence: BX647585
    2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000445270(uc010hvn.3) ENST00000356517(uc003ezc.3)

    miRNA
    Products:
         
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat AADACL2
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate AADACL2
    SwitchGear 3'UTR luciferase reporter plasmidAADACL2 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for AADACL2 (see all 4)
    OriGene shRNA RFP: AADACL2
    OriGene siRNA: AADACL2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat AADACL2
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2 (see all 3)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: AADACL2 (NM_207365)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for AADACL2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AADACL2 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for AADACL2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat AADACL2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat AADACL2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat AADACL2

    Additional cDNA sequence: 

    BC065724.1 BX647585.1 

    2 DOTS entries:

    DT.210964  DT.99979342 

    17 AceView cDNA sequences:

    AI130823 BX647585 NM_207365 BC065724 AA045911 BX118873 AI122615 AA027036 
    AL599128 AA045966 AA122299 AA122302 AA045778 CB851186 AA122269 AA045832 
    AA027115 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    AADACL2 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: ACTTCACCAT

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See AADACL2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for AADACL2

    SOURCE GeneReport for Unigene cluster: Hs.144710
        SABiosciences Custom PCR Arrays for AADACL2
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for AADACL2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat AADACL2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat AADACL2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat AADACL2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AADACL2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the last universal common ancestor (LUCA).

    Orthologs for AADACL2 gene from 5/16 species (see all 16)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves AADAC6
    Uncharacterized protein
    47(a)
    1 → many
    9(25019110-25024050)
    lizard
    (Anolis carolinensis)
    Reptilia --
    --
    49(a)
    1 → many
    3(17852058-17873020)
    zebrafish
    (Danio rerio)
    Actinopterygii BX000999.46
    --
    43(a)
    1 → many
    15(1040924-1061924)
    worm
    (Caenorhabditis elegans)
    Secernentea Y43F8A.36
    trcs-16
    (see all 4)
    Protein TRCS-1
    (see all 4)
    25(a)
    22(a)
    (see all 4)
    many ↔ many
    many ↔ many
    (see all 4)
    V(19377415-19381002)
    IV(9587081-9588817)
    E. coli
    (Escherichia coli)
    Gamma proteobacteria aes6
    acetyl esterase
    19(a)
    possible ortholog
    Chromosome(498238-499197)


    ENSEMBL Gene Tree for AADACL2 (if available)
    TreeFam Gene Tree for AADACL2 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for AADACL2 gene
    AADAC2  AADACL42  LIPE2  AADACL32  NCEH12  
    3 SIMAP similar genes for AADACL2 using alignment to 2 protein entries:     ADCL2_HUMAN (see all proteins):
    AADAC    NCEH1    AADACL3

    AADACL2 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/476 NCBI SNPs in AADACL2 are shown (see all 476    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 3 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1456698401,2
    --151449726(+) ACAGG-/AGAT  
            
    AGATA
    1 -- us2k10--------
    rs20096691,2
    C,F,A,--151449796(-) TATAGA/GTATAT 1 -- us2k14Minor allele frequency- G:0.28WA NA 242
    rs2003771141,2
    --151450182(+) ATATG-/CATA  
            
    TGTGT
    1 -- us2k10--------
    rs15843871,2
    C,H--151450183(-) ACATAT/CGCATA 1 -- us2k11Minor allele frequency- C:0.00NA 2
    rs583585061,2
    C,--151450183(+) TATGC-/ATAT  
            
    GTGTG
    1 -- us2k11Minor allele frequency- ATAT:0.00CSA 2
    rs15843861,2
    C,H--151450185(-) ACACAT/CATGCA 1 -- us2k11Minor allele frequency- C:0.00NA 2
    rs24108791,2
    --151450205(-) atacaC/Tacaca 1 -- us2k10--------
    rs2008667551,2
    --151450205(+) GTGTG-/TATGTAT 1 -- us2k10--------
    rs24108781,2
    C,--151450207(-) ATATAC/TACACA 1 -- us2k11Minor allele frequency- T:0.50NA 2
    rs1440979911,2
    --151450385(+) TTTCA-/GAGTCTAAGGGCATAGGAACT
    AGGAGCTCTGATATCCAAGGGCAG
    GAGTC
    1 -- us2k10--------

    HapMap Linkage Disequilibrium report for AADACL2 (151451704 - 151479127 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 1 variation for AADACL2
         1 CNV: 3457
    Human Gene Mutation Database (HGMD): AADACL2

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing AADACL2
    DNA2.0 Custom Variant and Variant Library Synthesis for AADACL2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    AADACL2 for disorders           About GeneDecksing

    4 diseases for AADACL2:    About MalaCards
    hermaphroditism    infertility    tuberculosis    mycobacterium tuberculosis


    Export disorders for AADACL2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for AADACL2 gene integrated from 9 sources:
    (articles sorted by number of sources associating them with AADACL2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Large-scale identification of human genes implicated in epidermal barrier function. (PubMed id 17562024)1 Toulza E.... Guerrin M. (2007)
    2. hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. (PubMed id 17207965)1 Lamesch P.... Vidal M. (2007)
    3. The full-ORF clone resource of the German cDNA consortium. (PubMed id 17974005)2 Bechtel S.... Schupp I. (2007)
    4. The DNA sequence, annotation and analysis of human chromosome 3. (PubMed id 16641997)2 Muzny D.M....Gibbs R.A. (2006)
    5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)2 Gerhard D.S....Malek J. (2004)
    6. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (2002)
    7. The Protein Data Bank. (PubMed id 10592235)7 Berman H.M....Bourne P.E. (2000)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 344752 HGNC: 24427 AceView: MGC72001 Ensembl:ENSG00000197953 euGenes: HUgn344752
    ECgene: AADACL2 H-InvDB: AADACL2

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for AADACL2 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for AADACL2 gene:
    Search GeneIP for patents involving AADACL2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for AADACL2  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for AADACL2   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for AADACL2  
     OriGene Protein Over-expression Lysate for AADACL2   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for AADACL2   Browse 3'-UTR reporter clones for miRNA target validation  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for AADACL2  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for AADACL2   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for AADACL2   OriGene Custom Protein Services for AADACL2  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat AADACL2
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing AADACL2
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat AADACL2
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat AADACL2
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat AADACL2
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat AADACL2
     GenScript Custom Purified and Recombinant Proteins Services for AADACL2 GenScript cDNA clones with any tag delivered in your preferred vector for AADACL2
     GenScript Custom Assay Services for AADACL2 GenScript Custom Superior Antibodies Services for AADACL2
     GenScript Custom overexpressing Cell Line Services for AADACL2 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in AADACL2 promoter
     Search Chromatin IP Primers for AADACL2
     RT2 qPCR Primer Assay in human, mouse, rat AADACL2
     Search GNC Networks for AADACL2
     SABiosciences Custom PCR Arrays for AADACL2
     Search Tocris compounds for AADACL2
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     AADACL2 antibodies
     AADACL2 proteins
     AADACL2 lysates
     Search for Antibodies for AADACL2 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for AADACL2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     AADACL2 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for AADACL2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for AADACL2
     SwitchGear 3'UTR luciferase reporter plasmids for AADACL2
     SwitchGear Promoter luciferase reporter plasmids for AADACL2
     Search ThermoFisher Antibodies for AADACL2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat AADACL2
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      AADACL2 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4